ID: 1086711077

View in Genome Browser
Species Human (GRCh38)
Location 11:90009978-90010000
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086711065_1086711077 19 Left 1086711065 11:90009936-90009958 CCCTCACCTTCCACAATCCCCTT No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711070_1086711077 1 Left 1086711070 11:90009954-90009976 CCCTTAAAAATTCCAGCCCAGAA No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711069_1086711077 2 Left 1086711069 11:90009953-90009975 CCCCTTAAAAATTCCAGCCCAGA No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711068_1086711077 9 Left 1086711068 11:90009946-90009968 CCACAATCCCCTTAAAAATTCCA No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711066_1086711077 18 Left 1086711066 11:90009937-90009959 CCTCACCTTCCACAATCCCCTTA No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711067_1086711077 13 Left 1086711067 11:90009942-90009964 CCTTCCACAATCCCCTTAAAAAT No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711071_1086711077 0 Left 1086711071 11:90009955-90009977 CCTTAAAAATTCCAGCCCAGAAC No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711064_1086711077 20 Left 1086711064 11:90009935-90009957 CCCCTCACCTTCCACAATCCCCT No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711063_1086711077 24 Left 1086711063 11:90009931-90009953 CCAGCCCCTCACCTTCCACAATC No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086711077 Original CRISPR TCCTTGGAAAGATGGATTTG AGG Intergenic
No off target data available for this crispr