ID: 1086715749

View in Genome Browser
Species Human (GRCh38)
Location 11:90059772-90059794
Sequence CCTCAGGAAAATGGTTACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086715749_1086715757 7 Left 1086715749 11:90059772-90059794 CCGAGGTAACCATTTTCCTGAGG No data
Right 1086715757 11:90059802-90059824 TAGAACTGGGTGTATGGTGATGG No data
1086715749_1086715755 1 Left 1086715749 11:90059772-90059794 CCGAGGTAACCATTTTCCTGAGG No data
Right 1086715755 11:90059796-90059818 CTTTCCTAGAACTGGGTGTATGG No data
1086715749_1086715760 18 Left 1086715749 11:90059772-90059794 CCGAGGTAACCATTTTCCTGAGG No data
Right 1086715760 11:90059813-90059835 GTATGGTGATGGAGGAGGCCCGG No data
1086715749_1086715754 -6 Left 1086715749 11:90059772-90059794 CCGAGGTAACCATTTTCCTGAGG No data
Right 1086715754 11:90059789-90059811 CTGAGGTCTTTCCTAGAACTGGG No data
1086715749_1086715759 13 Left 1086715749 11:90059772-90059794 CCGAGGTAACCATTTTCCTGAGG No data
Right 1086715759 11:90059808-90059830 TGGGTGTATGGTGATGGAGGAGG No data
1086715749_1086715753 -7 Left 1086715749 11:90059772-90059794 CCGAGGTAACCATTTTCCTGAGG No data
Right 1086715753 11:90059788-90059810 CCTGAGGTCTTTCCTAGAACTGG No data
1086715749_1086715761 19 Left 1086715749 11:90059772-90059794 CCGAGGTAACCATTTTCCTGAGG No data
Right 1086715761 11:90059814-90059836 TATGGTGATGGAGGAGGCCCGGG No data
1086715749_1086715758 10 Left 1086715749 11:90059772-90059794 CCGAGGTAACCATTTTCCTGAGG No data
Right 1086715758 11:90059805-90059827 AACTGGGTGTATGGTGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086715749 Original CRISPR CCTCAGGAAAATGGTTACCT CGG (reversed) Intergenic
No off target data available for this crispr