ID: 1086718008

View in Genome Browser
Species Human (GRCh38)
Location 11:90086671-90086693
Sequence AGATGCAACATTTGTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 2, 2: 0, 3: 9, 4: 147}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086717999_1086718008 29 Left 1086717999 11:90086619-90086641 CCCCCCATGAATGGATACCACAA No data
Right 1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG 0: 1
1: 2
2: 0
3: 9
4: 147
1086718001_1086718008 27 Left 1086718001 11:90086621-90086643 CCCCATGAATGGATACCACAAGT No data
Right 1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG 0: 1
1: 2
2: 0
3: 9
4: 147
1086718002_1086718008 26 Left 1086718002 11:90086622-90086644 CCCATGAATGGATACCACAAGTT No data
Right 1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG 0: 1
1: 2
2: 0
3: 9
4: 147
1086718004_1086718008 12 Left 1086718004 11:90086636-90086658 CCACAAGTTTCACCAAGATTCCT No data
Right 1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG 0: 1
1: 2
2: 0
3: 9
4: 147
1086718006_1086718008 0 Left 1086718006 11:90086648-90086670 CCAAGATTCCTGGTCAAGTAAAG No data
Right 1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG 0: 1
1: 2
2: 0
3: 9
4: 147
1086718003_1086718008 25 Left 1086718003 11:90086623-90086645 CCATGAATGGATACCACAAGTTT No data
Right 1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG 0: 1
1: 2
2: 0
3: 9
4: 147
1086718000_1086718008 28 Left 1086718000 11:90086620-90086642 CCCCCATGAATGGATACCACAAG No data
Right 1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG 0: 1
1: 2
2: 0
3: 9
4: 147
1086718007_1086718008 -8 Left 1086718007 11:90086656-90086678 CCTGGTCAAGTAAAGAGATGCAA 0: 1
1: 2
2: 3
3: 11
4: 122
Right 1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG 0: 1
1: 2
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086718008 Original CRISPR AGATGCAACATTTGTCAGTG AGG Intergenic
904397749 1:30233871-30233893 AGATGCAACAGTCCTCAGAGGGG - Intergenic
907881848 1:58556836-58556858 ACATGCAACACTTGCCAGAGTGG - Intergenic
908462889 1:64363315-64363337 AGCTGGACCATCTGTCAGTGTGG - Intergenic
911171687 1:94776669-94776691 AGATGCAACTAATGTCTGTGTGG + Intergenic
911509060 1:98789300-98789322 ATATTCAACATTTGTCAGATGGG - Intergenic
912406025 1:109438313-109438335 AGATCCCACATTTGTGAGTATGG - Intergenic
917170328 1:172165717-172165739 CTATGCAACATTTGTCACAGAGG - Intronic
918029379 1:180789784-180789806 AGATGCAACATAAGGCAATGAGG - Intronic
920794402 1:209124631-209124653 AGATAATACATTTGTGAGTGTGG + Intergenic
921597405 1:217069573-217069595 AGATGCAATATAAGTCAGAGTGG - Intronic
1063023191 10:2150184-2150206 AAAGTCAACATTTGTCAGGGGGG - Intergenic
1063324878 10:5088399-5088421 ATCTGCAACATTTATAAGTGGGG + Intronic
1064310133 10:14204946-14204968 AAATGCAACTTGTGTCTGTGTGG - Intronic
1065169391 10:23011282-23011304 AGATGCATCATTTATAAGTGTGG - Intronic
1068975817 10:63007876-63007898 AGATGCCATATTTGTAAGTGAGG - Intergenic
1069025837 10:63540376-63540398 ATTTGTAAAATTTGTCAGTGTGG + Intronic
1070979508 10:80633010-80633032 GGGTGCAGCATTTGGCAGTGTGG + Intronic
1076136407 10:128048117-128048139 ACATGTAACACTTTTCAGTGAGG + Intronic
1078889652 11:15542963-15542985 AGATGCACCACTTTTCTGTGTGG + Intergenic
1082177875 11:49082637-49082659 AGCTGCAACATTTGTCAGTGAGG + Intergenic
1084593518 11:70104138-70104160 AGAAGCAGCATCTGTAAGTGGGG + Exonic
1085255021 11:75167640-75167662 AGATGCAACAATTATTAGAGAGG - Intronic
1085444673 11:76592405-76592427 AAATGCAGCATTTCCCAGTGGGG - Intergenic
1086687843 11:89753223-89753245 AGCTGCAACATTTGTCAGTGAGG - Intergenic
1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG + Intergenic
1087141872 11:94771955-94771977 AGCTGCAATATTGGCCAGTGAGG - Intronic
1087858048 11:103116678-103116700 AGATGCAACATTCGTGACTCAGG - Exonic
1088903335 11:114135275-114135297 AGATGTACAATTTGTGAGTGTGG + Intronic
1089691554 11:120189896-120189918 GGACTCAACATTTGCCAGTGGGG + Intergenic
1092963261 12:13616525-13616547 GGAGGCACCATTTGTCATTGTGG - Exonic
1095113365 12:38323550-38323572 AGAAGCAAAATTTGACATTGAGG - Exonic
1095678808 12:44950407-44950429 AGTTGTAATATTTGTGAGTGAGG - Intergenic
1096415490 12:51408717-51408739 AGATGCAACATCACTCTGTGTGG - Intronic
1097166934 12:57091042-57091064 AGAGGGAACAATTGTTAGTGTGG + Intronic
1099275040 12:80563909-80563931 GTATTCAACATTTGTCAGTATGG + Intronic
1101260643 12:103026176-103026198 AGATGGCACATTACTCAGTGGGG + Intergenic
1101260907 12:103028714-103028736 AGATGGCACATTACTCAGTGGGG - Intergenic
1103662009 12:122527520-122527542 AGATGAAACACTTGTCAGTTAGG - Intronic
1104671280 12:130682213-130682235 AGATGCATCCCTTGGCAGTGGGG - Intronic
1107137413 13:36959107-36959129 ATATGCAACATTTGTCTTTCTGG - Intronic
1108803340 13:54127149-54127171 AGAAGCAACATGAGTCATTGGGG - Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109790265 13:67237708-67237730 AGATAAAACATTTGTCACTAAGG - Intergenic
1111514660 13:89313475-89313497 ACTTGCAATAATTGTCAGTGAGG - Intergenic
1111612386 13:90620843-90620865 AGGTGCAACCCTTGTCAGAGTGG - Intergenic
1112344719 13:98579508-98579530 GGATGAAACAATGGTCAGTGTGG - Intergenic
1116274737 14:42818137-42818159 AGATGATACATGTGTTAGTGTGG + Intergenic
1117060423 14:51956883-51956905 AGATGAAGCAGTTGTCAGTAAGG - Intronic
1121165264 14:91790309-91790331 TGGTGAAACAGTTGTCAGTGTGG + Intronic
1121638047 14:95466906-95466928 AGATGTCACAGATGTCAGTGGGG - Intronic
1121948568 14:98147771-98147793 AGATGGAACATGTCTCACTGTGG - Intergenic
1129707433 15:77802774-77802796 AGATGGAACATGGGTGAGTGTGG - Intronic
1130430392 15:83841766-83841788 AAATGCAACATTTGGGTGTGAGG - Intronic
1131883337 15:96882217-96882239 AGAGGCAAGATTTGGCAGTGAGG + Intergenic
1137762348 16:50950738-50950760 ACATGCTACATGTGCCAGTGAGG - Intergenic
1137837343 16:51605504-51605526 AGATGCTACCTGTTTCAGTGAGG - Intergenic
1139597949 16:67968863-67968885 AGATGCAACATTTGTAAAATGGG + Intronic
1141121832 16:81364925-81364947 AGAGGCAACATTTCTCATTCAGG - Intronic
1143849665 17:9800971-9800993 AGAAGCAGCATTTGTCAGGCAGG + Intronic
1148917953 17:50999737-50999759 AAAAGAAACATTTATCAGTGAGG + Intronic
1149132223 17:53316380-53316402 AAATGCAACATTTGGCAGGAAGG + Intergenic
1150203474 17:63380840-63380862 AAATACAAGATTTGTCACTGTGG - Intronic
1152367818 17:79866898-79866920 AGTAGCAACAGTTGACAGTGAGG + Intergenic
1153816126 18:8791677-8791699 AAATGCAAAATTAGTCATTGAGG + Intronic
1154134305 18:11762256-11762278 ATAAGCAACAGTTTTCAGTGGGG + Intronic
1157437948 18:47687108-47687130 ACAGGCAACATCTGACAGTGCGG - Intergenic
1157726201 18:49966032-49966054 AGCTGCAACATTTCTCTCTGGGG - Intronic
1157906687 18:51575401-51575423 AGATCCACCATTAGCCAGTGTGG - Intergenic
1167952441 19:53038042-53038064 GGAGGCAACATTTACCAGTGAGG + Intergenic
1168447095 19:56428753-56428775 AGAGGAAACATTTATCAGTTGGG - Intronic
929308837 2:40398891-40398913 GTTTGCAAAATTTGTCAGTGTGG + Intronic
930906403 2:56573401-56573423 ATATGCAACATTTTTTAGTAAGG + Intergenic
931859960 2:66344692-66344714 ATATGTATCATTTCTCAGTGGGG - Intergenic
934582078 2:95450743-95450765 AGCTGCAACATTTGTCCCTGAGG - Intergenic
934597372 2:95625971-95625993 AGCTGCAACATTTGTCCCTGAGG + Intergenic
934842516 2:97637023-97637045 AGCTGCAACATTTGTCCCTGAGG - Intergenic
936391737 2:112080944-112080966 AAATTCAGCATTTGTTAGTGTGG + Intronic
936653554 2:114457580-114457602 GGATGCAGCATTTGTCAATCAGG + Intronic
937661254 2:124432165-124432187 AGATGCAATATCTGTCTATGGGG + Intronic
940601674 2:155870618-155870640 AAACTCAACATTTTTCAGTGTGG + Intergenic
941616389 2:167725416-167725438 AGATGCAACATTTATTCCTGAGG - Intergenic
943622522 2:190165668-190165690 AGGTCCAACATATGTCAGAGAGG + Intronic
945751402 2:213789600-213789622 ACATTCAACATTTGACAGTTCGG + Intronic
945897370 2:215498799-215498821 AGAAGCTATATTTATCAGTGTGG - Intergenic
948089841 2:235283491-235283513 AGGAGCAACATTTGGCAGTTTGG - Intergenic
1170369667 20:15635556-15635578 AGATGCAACAATAGACATTGAGG + Intronic
1171724687 20:28605252-28605274 AGATACAACATTTATACGTGTGG + Intergenic
1173036564 20:39417262-39417284 AAATGGAACATGTTTCAGTGTGG - Intergenic
1175212159 20:57366632-57366654 ACATGCAAACTCTGTCAGTGAGG + Intronic
1178502663 21:33138798-33138820 AGCTGCCACATTTAACAGTGAGG + Intergenic
1179252514 21:39684091-39684113 TGATAAAACATTTGTAAGTGGGG + Intergenic
1180298238 22:10963943-10963965 AGATACAACATTTATACGTGTGG + Intergenic
1183876098 22:40783334-40783356 AGATGCCACATTTGACCCTGTGG + Intronic
1185348021 22:50319094-50319116 AGCTGCAGCATCTGTCTGTGGGG + Intronic
952739446 3:36721468-36721490 AAATGAAACATTTGTTAGTAAGG + Intronic
958028748 3:88081441-88081463 GTCTGCAACATTTGTCATTGTGG + Intronic
959295202 3:104527070-104527092 AGATGCAAGATGAGTCAGTTAGG - Intergenic
961224814 3:125233604-125233626 AAATGCCACATTCGTCAGTTGGG - Exonic
970301903 4:14690620-14690642 AGAAGCAATATATGTCAGTGTGG - Intergenic
970905391 4:21210199-21210221 AGAGGCAACAATTGTTAATGAGG - Intronic
973693296 4:53463515-53463537 AGCTGCCACATTTCCCAGTGGGG - Intronic
974712691 4:65621293-65621315 AGAAGCAGCATATGTCACTGTGG + Intronic
976761700 4:88556169-88556191 AGATGCTTCATTTTTCACTGAGG - Intronic
977142602 4:93392805-93392827 AGATACAGCATTTTTCATTGAGG - Intronic
978402377 4:108344230-108344252 AGAAGCAACATTTTTCAAAGTGG - Intergenic
978945725 4:114493887-114493909 AGATGCAACAATAGGCACTGGGG + Intergenic
981454187 4:144934162-144934184 AGGTGAAACAGCTGTCAGTGAGG - Intergenic
982875542 4:160644192-160644214 AGATGAAAGATTTTTCAGTGAGG - Intergenic
983445990 4:167852971-167852993 AGGTGGAACATTTGTCCTTGGGG - Intergenic
984986716 4:185338060-185338082 AGATGAAACCTCTGTCAGAGAGG + Intronic
987111653 5:14693243-14693265 TGATGCAATATATTTCAGTGGGG + Exonic
987819617 5:22946153-22946175 AGAAACAATATTTCTCAGTGAGG + Intergenic
989372515 5:40723885-40723907 AAAGGCAAGATGTGTCAGTGAGG + Intronic
989414129 5:41153681-41153703 AGATGCAAGTTTAGACAGTGTGG - Intronic
990847713 5:60162558-60162580 AAAGGCAGCATTAGTCAGTGTGG + Intronic
995562506 5:113398177-113398199 AAAAATAACATTTGTCAGTGAGG + Intronic
996438652 5:123464001-123464023 AGATATAACAAGTGTCAGTGAGG - Intergenic
996464885 5:123788706-123788728 ACACCCAACATTTGTCAGTTAGG - Intergenic
998925325 5:147117457-147117479 ATATGCAATATTTGTCTTTGGGG + Intergenic
1001383868 5:171321897-171321919 AGATCCAAGAATTGTCAGTCTGG - Intergenic
1006523092 6:34583450-34583472 AGAGGCAACACTTGTCCTTGAGG + Intergenic
1007711163 6:43825357-43825379 AGATGCAGCCTTTCTCAGGGGGG + Intergenic
1009287383 6:61837607-61837629 AGGTGCTACTTTTGCCAGTGTGG - Intronic
1009333484 6:62455662-62455684 AGATGCAAAACTTTTGAGTGTGG - Intergenic
1010629353 6:78178919-78178941 AAAAGCAACAGTTATCAGTGAGG + Intergenic
1011203369 6:84863063-84863085 ACATGCAATATTTATCAGTTGGG + Intergenic
1011972830 6:93249150-93249172 ATATGCAACATTTGTAATTATGG - Intronic
1012155412 6:95813411-95813433 AGATTCAGCCATTGTCAGTGGGG + Intergenic
1015122645 6:129716677-129716699 AGATGCTCCATTTGTAAGTAGGG - Intergenic
1017056384 6:150440038-150440060 AAATGCAACTTTTGTGTGTGTGG + Intergenic
1018233183 6:161695549-161695571 AAATGCAACACTTTTGAGTGAGG - Intronic
1022252188 7:28619369-28619391 AGCAGAAACATTTGCCAGTGAGG - Intronic
1023584100 7:41710930-41710952 AGATGCTACTTTTGTGTGTGGGG - Intergenic
1023604853 7:41920560-41920582 AGATGCAACATTTTTCTGGTGGG - Intergenic
1024602565 7:50996739-50996761 AGATGCAACAATAGACACTGGGG - Intergenic
1024955141 7:54910546-54910568 AGCTGCAACCTTTGTTACTGTGG - Intergenic
1026375813 7:69749748-69749770 AGAAGCAACATTTGTCAACATGG - Intronic
1028292198 7:89079156-89079178 AGAGGCACCATTTGTGAATGAGG + Intronic
1028386902 7:90265227-90265249 TGAAGCATCATTTGTAAGTGGGG - Intronic
1030159242 7:106490678-106490700 AGATGGAGCATCTGTCAGTTTGG + Intergenic
1030367921 7:108667695-108667717 AGATGCAACATTTGACTGATAGG - Intergenic
1031412590 7:121457355-121457377 AAATGCCACATTTGTGGGTGTGG + Intergenic
1038494593 8:27992485-27992507 AGATGCAACCTGTGGCAGAGTGG + Exonic
1041377022 8:57215647-57215669 AGATTCCACGTTTGGCAGTGGGG + Intergenic
1042174992 8:66029850-66029872 AGCTGAAACTTTTGACAGTGAGG + Intronic
1043987356 8:86709251-86709273 AAATGTAACATGTGTCTGTGTGG - Intronic
1046223298 8:111243153-111243175 AGATACAACATTTGATAGTAGGG - Intergenic
1046904550 8:119558502-119558524 ATCTGCAACTTGTGTCAGTGGGG - Intronic
1051457494 9:17276457-17276479 AGCTCCATCATTTATCAGTGAGG - Intronic
1057532303 9:95860618-95860640 TTATGAATCATTTGTCAGTGGGG + Intergenic
1187026563 X:15441493-15441515 AGATGAGAAATTTATCAGTGTGG - Intronic
1187756682 X:22535214-22535236 AAATGCAGCATTTGTCGTTGAGG - Intergenic
1187864644 X:23713157-23713179 GGATGCAACATTTGTAATGGTGG - Exonic
1188127036 X:26381814-26381836 AGATGAAAAATTTGTGAATGTGG + Intergenic
1189708086 X:43779721-43779743 AGAGGTAACATTGGTCATTGAGG + Intronic
1191033182 X:55997260-55997282 AGAAGCATCATTAGCCAGTGCGG + Intergenic
1193199477 X:78671404-78671426 AGAAGAAACTTTTCTCAGTGTGG + Intergenic
1195459876 X:105112700-105112722 AAATGCAACATAAGTCTGTGTGG + Intronic
1200150393 X:153948644-153948666 AAATGCAGCAGTTGGCAGTGCGG + Exonic