ID: 1086722901

View in Genome Browser
Species Human (GRCh38)
Location 11:90144187-90144209
Sequence TCTTCATTCATTAAAGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086722901_1086722907 29 Left 1086722901 11:90144187-90144209 CCCCCAACTTTAATGAATGAAGA 0: 1
1: 0
2: 1
3: 18
4: 212
Right 1086722907 11:90144239-90144261 TACATACCTAGAAGGTGTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 139
1086722901_1086722906 21 Left 1086722901 11:90144187-90144209 CCCCCAACTTTAATGAATGAAGA 0: 1
1: 0
2: 1
3: 18
4: 212
Right 1086722906 11:90144231-90144253 GATGACAGTACATACCTAGAAGG 0: 1
1: 0
2: 3
3: 9
4: 117
1086722901_1086722908 30 Left 1086722901 11:90144187-90144209 CCCCCAACTTTAATGAATGAAGA 0: 1
1: 0
2: 1
3: 18
4: 212
Right 1086722908 11:90144240-90144262 ACATACCTAGAAGGTGTAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086722901 Original CRISPR TCTTCATTCATTAAAGTTGG GGG (reversed) Intronic
905016153 1:34780314-34780336 TTCTCATTCATAAAAGTAGGAGG + Intronic
905055547 1:35090516-35090538 TCTTTTTTCATTAAAGTTCTGGG - Intronic
906947527 1:50307880-50307902 TCTTCCAGCATTAAAGTTGTTGG + Intergenic
907979833 1:59470815-59470837 TCTTCATTCTTTATAGTGTGTGG + Intronic
908582149 1:65526725-65526747 TCCTCATTTTTTCAAGTTGGAGG + Intronic
908684850 1:66704732-66704754 TCTTCATTCATTTATGTCAGAGG - Intronic
908869638 1:68594308-68594330 TCTTAATTAATTAATCTTGGTGG + Intergenic
910849172 1:91634468-91634490 TCTTCAGTCATAAAAATGGGTGG - Intergenic
911306210 1:96235379-96235401 TCTCCTTTCAGTAAAGTTGAAGG + Intergenic
911341232 1:96641216-96641238 TCTTCATTCATTTTAATGGGTGG - Intergenic
911784376 1:101926678-101926700 TCTTCACTTACTAAAGTAGGAGG + Intronic
912334856 1:108852988-108853010 TTTTCATTTATTAAATTTTGAGG + Intronic
913012821 1:114701383-114701405 TCCTCCTTCCTTGAAGTTGGGGG + Intergenic
913378196 1:118178748-118178770 TCAACATTCAGTAAAGTTGCAGG + Intronic
914007625 1:143746531-143746553 ACTTCATTCATTATAATTGTAGG + Intergenic
916335689 1:163668793-163668815 TCTCCATTCATCAAATATGGTGG + Intergenic
917277312 1:173344711-173344733 TCTCCAGATATTAAAGTTGGAGG - Intergenic
918950795 1:191134221-191134243 GCTTCATAAATTAAATTTGGAGG - Intergenic
923663104 1:235975803-235975825 TCTTCATTCAGAAAAGATAGAGG + Intergenic
924949515 1:248869378-248869400 AATTAATTCAGTAAAGTTGGAGG + Intergenic
1062990684 10:1812475-1812497 TATTCATTCCTTAAACTTTGGGG + Intergenic
1063163748 10:3441259-3441281 TCTTCATCCATAAAATTAGGTGG - Intergenic
1063317901 10:5024220-5024242 TCTTCCTACATTGAAGTTGGTGG + Intronic
1065411907 10:25438670-25438692 GCTCCTTTCATTAAATTTGGAGG - Intronic
1067933787 10:50590503-50590525 TCATACTTCAATAAAGTTGGAGG - Intronic
1069809619 10:71148743-71148765 TCTCCATTCCTTAAAGGGGGAGG - Intergenic
1070681158 10:78450056-78450078 TCCTCATTTATTAAAGTGGAAGG + Intergenic
1073066632 10:100763908-100763930 TCTTCACTCATAAAATGTGGGGG + Intronic
1074879444 10:117642694-117642716 TCCTCTTTCATTAATGTTGTTGG + Intergenic
1077571740 11:3345434-3345456 TCTTCTTTGATTGGAGTTGGAGG + Intronic
1077915082 11:6606308-6606330 TCTTTATTTTTTAAAATTGGTGG + Intronic
1078021133 11:7656773-7656795 TCTCCAGTCATCAGAGTTGGGGG - Intronic
1079525593 11:21383929-21383951 TCTTCTTTCATTATATTTGATGG + Intronic
1080062511 11:27972027-27972049 TATTCACTCATAAAAGGTGGAGG + Intergenic
1080622072 11:33995032-33995054 TCTTCCTTCCTTAAATGTGGAGG + Intergenic
1083600431 11:63944125-63944147 TCTTGGTTGATTAAAGTAGGAGG + Intronic
1084077234 11:66789360-66789382 TTTTCCTTCCTTAGAGTTGGTGG + Intronic
1085616028 11:77999460-77999482 TCTTAAGTCATTACATTTGGGGG + Intergenic
1086722901 11:90144187-90144209 TCTTCATTCATTAAAGTTGGGGG - Intronic
1087044525 11:93833748-93833770 TCTTCATTCTTTAAACATGTTGG + Intronic
1087989005 11:104724093-104724115 AATTCATTCAGTAAAGTTGCAGG - Intergenic
1088567497 11:111187983-111188005 TCTACATTCTTTATAGTTTGAGG - Intergenic
1090792603 11:130104740-130104762 TATTCATTTATTAAAGTAGAAGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093074555 12:14744351-14744373 TTTTCATTCAATAAAGTTTAAGG + Intergenic
1093270938 12:17060502-17060524 TCTTCATATATTGGAGTTGGAGG + Intergenic
1093608969 12:21130960-21130982 TGTTTATTCAATTAAGTTGGTGG - Intronic
1093791181 12:23252086-23252108 TCTGCATGCATGAAAGTTTGAGG + Intergenic
1095230443 12:39732961-39732983 TCTTCATTTTTTTAAATTGGAGG + Intronic
1096686487 12:53291638-53291660 TCTTCATTCATGATAGCTGCTGG - Intronic
1096929373 12:55188837-55188859 TTTTCATTCATGAAATTTGTAGG + Intergenic
1097160711 12:57044754-57044776 TTTTGTTTCATAAAAGTTGGGGG - Intronic
1097677727 12:62621085-62621107 TTTTCATTCATTAGAGATGGAGG + Intergenic
1098170741 12:67744476-67744498 TCTTATTTCAATAAAGCTGGAGG + Intergenic
1099747103 12:86719114-86719136 TCTTCATTCATTTAAGAGGTAGG - Intronic
1100414786 12:94360406-94360428 TTTTAATTCATTAAAGTTTCAGG + Intronic
1101349433 12:103915083-103915105 TTTTCAATCATTAAAGTGGCTGG + Intergenic
1103150681 12:118635974-118635996 TCTTCTTGTATTACAGTTGGAGG + Intergenic
1105392476 13:19993476-19993498 TCTTCGTTCAATAAAATTGGAGG - Exonic
1106563261 13:30864452-30864474 TCTCCATTCAGGAAAGCTGGGGG - Intergenic
1107711954 13:43159281-43159303 TTTTCATTCTTTAGAGTGGGAGG + Intergenic
1109127511 13:58535754-58535776 TCTTAATTTATTAAAATTAGTGG - Intergenic
1109646984 13:65271820-65271842 TCTCCATTCTGTAAGGTTGGAGG + Intergenic
1110242394 13:73283566-73283588 TCAGCATTCAGTAAAGTAGGGGG + Intergenic
1110470130 13:75850606-75850628 TCTTAACTCACTAAATTTGGAGG - Intronic
1111068176 13:83125175-83125197 TCTTCTTTTATCAAATTTGGTGG - Intergenic
1111480365 13:88816165-88816187 AATTCATTCAGTAAAGTTGCTGG + Intergenic
1113459793 13:110473725-110473747 TCATCTTTCATTAAAGCTCGGGG - Intronic
1117112287 14:52470894-52470916 TCTTCAGCCAGTAGAGTTGGAGG + Intronic
1117466990 14:56003675-56003697 TTTTCTTTTTTTAAAGTTGGGGG + Intergenic
1119678478 14:76574229-76574251 TCTTCATCTATTAAAGGAGGAGG + Intergenic
1122471463 14:101969905-101969927 TCCTCATTCATGAAAGATGAGGG - Intronic
1125239629 15:37558728-37558750 TCTGCATTCTTTAATTTTGGGGG - Intergenic
1126365047 15:47885697-47885719 CCTTCATGCATCAAAGTGGGTGG + Intergenic
1126403453 15:48298588-48298610 TCTACAATCATTAAACTTGTGGG + Intronic
1127791644 15:62403735-62403757 TCTTCCTGGCTTAAAGTTGGGGG + Intronic
1128891932 15:71339336-71339358 TCCTGAGTCATTAAACTTGGGGG - Intronic
1131822504 15:96286992-96287014 TCTTCCTTCATGGGAGTTGGAGG - Intergenic
1134075871 16:11290902-11290924 TCTCCATACATTAGAGTTGGTGG - Intronic
1137291820 16:47056648-47056670 TTTTCACTCATTCTAGTTGGAGG + Intergenic
1137997867 16:53239095-53239117 TCATCATTCCTAAAAGATGGAGG - Intronic
1138047785 16:53743906-53743928 TGTTAATTCATTATAGTTGTGGG + Intronic
1138905540 16:61326663-61326685 TCTTTATTCATTAATTTTGACGG + Intergenic
1139332314 16:66202888-66202910 TCTTTATACATAAAAGGTGGGGG + Intergenic
1145854053 17:28135063-28135085 TCTTTATTCTTTTTAGTTGGTGG + Intronic
1146463849 17:33069934-33069956 TCTTCATTTACTGCAGTTGGAGG - Intronic
1149393539 17:56216112-56216134 GCTTCATACATAAAATTTGGGGG - Intronic
1150367297 17:64600739-64600761 TCTTCATTTATTGAGGGTGGAGG - Intronic
1150967832 17:69991718-69991740 TCTTCATTGATTAATGATGGGGG - Intergenic
1153404532 18:4721841-4721863 TCTTCATTCATTAAATATTCTGG + Intergenic
1155119705 18:22805857-22805879 TTTTCATTTTTTAAAGATGGAGG - Intronic
1155920892 18:31601772-31601794 TCTTAATTCCCTAAAGCTGGAGG - Intergenic
1156104656 18:33645246-33645268 TCTTGATTCCTTAAAGTTTATGG + Intronic
1156265264 18:35482402-35482424 TCTACATTCATTCATGTTGGGGG + Intronic
1159020863 18:63142066-63142088 CCTTCATTTATTAAACGTGGAGG + Intronic
1159459084 18:68699486-68699508 TCTTTATATATTAAAGTTTGTGG - Intronic
1160085710 18:75775715-75775737 TCTGCATTCATAATAGTAGGTGG + Intergenic
1164042276 19:21504296-21504318 TCTTCATATCTTAAAGTTAGAGG + Intronic
1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG + Intergenic
927783559 2:25957204-25957226 TCTTCATTTATTAAATGCGGAGG - Intronic
928076142 2:28266452-28266474 TCTTCATTCATAAATGTAAGTGG + Intronic
928476882 2:31636385-31636407 TCATAATTCAGTAAAGTTGCAGG - Intergenic
929375568 2:41282655-41282677 TGTTCATTCATTTAATTTTGTGG + Intergenic
929834704 2:45384742-45384764 TCCTCATTCATTTAAGCTGAGGG - Intergenic
931891465 2:66677611-66677633 TTTTCTTTCAACAAAGTTGGGGG + Intergenic
936408801 2:112235496-112235518 TCCTCATTCATAAAATATGGAGG + Intronic
936887440 2:117329795-117329817 TCCTCAATCAGTCAAGTTGGAGG - Intergenic
939656439 2:144831725-144831747 TCTTCATTCATTCATAATGGTGG - Intergenic
940797031 2:158090766-158090788 TCTTCATTTCTAAAACTTGGGGG - Intronic
941257588 2:163252767-163252789 TCTTCCTTCATTAAATTTCTTGG + Intergenic
943322214 2:186458399-186458421 TCTTCAAGCAGTAAAGTTTGTGG + Intergenic
943790803 2:191930520-191930542 TGTTCATCCACTAAAGCTGGAGG - Intergenic
944321153 2:198344177-198344199 TCTTCATTCAGAATAATTGGGGG - Intronic
945556865 2:211287678-211287700 TCTTCAGTCATTGAAGCTGATGG - Intergenic
946123394 2:217536883-217536905 TCTTCATCCCTTCAAGTTGTTGG - Intronic
1171943852 20:31357672-31357694 TCTTTTTTCATTAAAGTATGTGG + Intergenic
1176252063 20:64129906-64129928 TCTTCATTCATTATTGTTGGGGG + Intergenic
1177681538 21:24377825-24377847 TCTTCATAAATTTAAGTTTGTGG - Intergenic
1177753149 21:25310920-25310942 TATGCATTCAATAAAGTTGCAGG + Intergenic
1179128012 21:38609373-38609395 TCTTCATTCTTTGAAATTTGTGG - Intronic
1179478765 21:41664848-41664870 TCTTCATATCTTGAAGTTGGTGG - Intergenic
954101185 3:48373884-48373906 TCTTCATTCAGCACAGATGGTGG - Intronic
954428691 3:50457728-50457750 TCTTCATATATAAAAGGTGGAGG - Intronic
955859074 3:63307644-63307666 TATTTTTTCATTAAAGTTGAAGG + Intronic
956206743 3:66762691-66762713 ACCTCTTTCATTCAAGTTGGTGG - Intergenic
956542074 3:70351274-70351296 TATTTATTCATAAAATTTGGAGG - Intergenic
958153936 3:89729109-89729131 TCTAAATTCAATAAAGTTGCAGG + Intergenic
958671442 3:97210729-97210751 TCTTAAGTCATTAAATTTGGGGG - Intronic
959412377 3:106040686-106040708 TTTCCATTTATTTAAGTTGGTGG + Intergenic
959575337 3:107927538-107927560 TCATCACTCATGAAAGTCGGAGG - Intergenic
961237538 3:125380326-125380348 TATTCATGTATTAAAGTTGTGGG + Intergenic
961989781 3:131176091-131176113 TCTTCAGTCTTTATAGTTGGGGG + Intronic
962017700 3:131459250-131459272 TCTTCTTTCACTATAGTCGGTGG - Intergenic
964337129 3:155667387-155667409 TATTCCTTTATTAAAGTTGCTGG - Intronic
964563047 3:158019653-158019675 TCTCCATTCATTAAAGTTTTTGG + Intergenic
965132302 3:164716504-164716526 TCAACATTTAATAAAGTTGGTGG - Intergenic
965587347 3:170330674-170330696 TCTTCTTTCATTGAATTTGAAGG - Intergenic
966708257 3:182941992-182942014 ACTTCATTCATTTAAGTCTGAGG + Exonic
967428618 3:189355838-189355860 TCTGTCTTCATTAAAGTTTGAGG + Intergenic
969567923 4:7991078-7991100 TCTTAATTCTGTAAAGTTTGAGG + Intronic
971535570 4:27745356-27745378 TCTGTATTCATTAAAGATGTTGG + Intergenic
971960402 4:33479015-33479037 TTCTCTTTCATTAAAGTTGGTGG - Intergenic
972293182 4:37710804-37710826 TGTTCATTCATTTAAGTTTTAGG + Intergenic
973710970 4:53630076-53630098 TCTTCATTAAAAAAAGGTGGGGG + Intronic
976796094 4:88934750-88934772 TCTTACTTCACTTAAGTTGGAGG - Intronic
977007918 4:91595273-91595295 TCTTCATTCTCTATAGTTGTTGG + Intronic
977367466 4:96089015-96089037 GATACATTCATTAAAGTTGCAGG + Intergenic
984032087 4:174616885-174616907 ACTTCATTCATTCAAGTTCACGG - Intergenic
984836166 4:184023688-184023710 TCTTTTTCCATGAAAGTTGGGGG + Intergenic
985483493 5:134809-134831 TAATAATTCATCAAAGTTGGAGG + Intergenic
986103697 5:4639111-4639133 TCTTCATTTATCAAAGTCTGAGG - Intergenic
986551642 5:8962623-8962645 TTTTCTTTTATTAAAGTTAGGGG + Intergenic
986874261 5:12087889-12087911 TATTCATTCATTAAACTGGGTGG + Intergenic
987567571 5:19612830-19612852 TCTGCATTCCTTAAAGTAGATGG + Intronic
989762414 5:45033453-45033475 TCCTGATTAATTAAAGTTTGTGG + Intergenic
992279949 5:75164079-75164101 TCTTGATTCATTAACCCTGGGGG + Intronic
994400086 5:99267837-99267859 TCTTTATTCATTAAACTTATTGG + Intergenic
994565237 5:101437399-101437421 TTTTCATCCATTGAATTTGGAGG - Intergenic
994752738 5:103758844-103758866 ACTTCCTTCAGTACAGTTGGTGG + Intergenic
995030082 5:107470502-107470524 TCTTATTTGATTAAAATTGGAGG + Intronic
998532903 5:142901919-142901941 TCTTCCTTCATTACAGCTGCTGG + Exonic
999802027 5:155047144-155047166 TCTCCATTCCTAAAAGTAGGGGG - Intergenic
1000682729 5:164206178-164206200 TCTTCAGTAATTAACTTTGGAGG - Intergenic
1004729199 6:18341233-18341255 TTGTCATTCCTTAAAGTGGGTGG + Intergenic
1004822314 6:19381128-19381150 TCTGCTTTCATGCAAGTTGGTGG + Intergenic
1004949972 6:20658596-20658618 TCTTCATAAATTGAAGTTGGGGG + Intronic
1006007338 6:31012975-31012997 TCTTGATTCAGTAAGCTTGGTGG + Intronic
1008332207 6:50259111-50259133 TCTTCAATCTTTAAAGTTGCTGG + Intergenic
1009034933 6:58105674-58105696 TCTTCCTTTAATAAAGTTTGTGG - Intergenic
1009210449 6:60856391-60856413 TCTTCCTTTAATAAAGTTTGTGG - Intergenic
1010014894 6:71093117-71093139 ACTTGATCCATAAAAGTTGGTGG - Intergenic
1011574278 6:88777663-88777685 TGTTAATTCAATAAAGTTGTGGG - Intronic
1012409509 6:98940481-98940503 TCTTCATCCATTCTAGTGGGTGG + Intronic
1012469884 6:99559536-99559558 TTTTCAGTTATTATAGTTGGAGG - Intronic
1013651121 6:112195722-112195744 CTTTCATGCATTAAATTTGGTGG - Intronic
1018395739 6:163376819-163376841 TCTTCATTCAATACACTCGGGGG + Intergenic
1019591733 7:1839148-1839170 TCCTCAGTCATTTAGGTTGGGGG + Intronic
1019957798 7:4429882-4429904 AATGCATTCAGTAAAGTTGGAGG + Intergenic
1020758922 7:12243236-12243258 TCTTCATACATTAAAATGTGAGG - Exonic
1021743429 7:23712043-23712065 TCTTCATTCATTATTAATGGTGG + Intronic
1022289752 7:28989498-28989520 CCTTCATCTATTAAAGTAGGTGG + Intergenic
1023320933 7:38996867-38996889 TGTCCATTCATTAAAGGTGGGGG - Intronic
1023365731 7:39461316-39461338 TATTCATTTATTTAATTTGGGGG - Intronic
1024231658 7:47368017-47368039 TCTTCCTTCGTGAATGTTGGTGG - Intronic
1025954401 7:66171273-66171295 CCTTCATTCATTTATTTTGGGGG + Intergenic
1026852934 7:73736107-73736129 TCTTTATTCATTAAAGCCTGAGG + Exonic
1027732156 7:81887951-81887973 TCTTAACTCCTTCAAGTTGGGGG - Intergenic
1028738521 7:94246008-94246030 CCTTCATTAGTTAAAGATGGAGG - Intergenic
1031636216 7:124104120-124104142 TCTTGATTCATCAGACTTGGAGG + Intergenic
1032812302 7:135432672-135432694 TCTTTATTCCTTCATGTTGGTGG + Intronic
1033800398 7:144894580-144894602 TCTTTATTCACTAGAGTAGGTGG + Intergenic
1036652294 8:10652902-10652924 TTTTCAGACATTAATGTTGGAGG + Intronic
1037108640 8:15139969-15139991 CCTCTATGCATTAAAGTTGGTGG + Intronic
1037442654 8:18932296-18932318 TTTGCATTCAGTAAAGTGGGAGG + Intronic
1037675467 8:21047320-21047342 TCTTCATTCCTGAAGGTTGTGGG + Intergenic
1038016157 8:23516929-23516951 TCTCCATTCCTGGAAGTTGGTGG - Intergenic
1038589561 8:28824297-28824319 TGGTGAATCATTAAAGTTGGGGG - Intronic
1038686523 8:29723837-29723859 TCTTCCTTCATTTTAGATGGAGG + Intergenic
1042514037 8:69641333-69641355 TGTTCATTCATTAACTTTGGTGG + Intronic
1042754187 8:72191802-72191824 TCTACATTTATTACAGTTAGAGG - Intergenic
1042957771 8:74270630-74270652 TTTTCCTTCATTAAAAATGGTGG + Intronic
1043107198 8:76129155-76129177 TCTTCATCCATTATAGTTTTGGG + Intergenic
1043553862 8:81406600-81406622 TTTTGATTCAGTAAATTTGGTGG + Intergenic
1044130060 8:88510914-88510936 TATGAATTCAGTAAAGTTGGAGG + Intergenic
1045860766 8:106812679-106812701 TCATCATTTATTAAAAATGGTGG - Intergenic
1046096711 8:109571154-109571176 TCTCCATCAATTCAAGTTGGAGG - Intergenic
1047904518 8:129459173-129459195 CCTTCATTCATTTAATTTGATGG - Intergenic
1050368728 9:4898964-4898986 TCTTCTTTCATTAATGTGGCTGG + Intergenic
1050922260 9:11218611-11218633 TCTCCATTCATAGAAGTTGTGGG - Intergenic
1052713531 9:32087606-32087628 TCTTTATTCATTCAAATTGATGG - Intergenic
1052763539 9:32617383-32617405 TCTCCATTCCTCAAACTTGGAGG - Intergenic
1053291549 9:36882699-36882721 TCTTCATTCAGTGAAGATGCAGG + Intronic
1053591411 9:39518118-39518140 TGTTCATTCACTAAATTAGGAGG - Intergenic
1053849254 9:42273477-42273499 TGTTCATTCACTAAATTAGGAGG - Intergenic
1054574896 9:66847171-66847193 TGTTCATTCACTAAATTAGGAGG + Intergenic
1055425484 9:76191427-76191449 TCTTCATTTTTTACAGATGGTGG - Intronic
1055729984 9:79270621-79270643 TCTATACTCATTAAAGTTTGAGG - Intergenic
1056398833 9:86207485-86207507 TCATGATGCATTAAATTTGGGGG + Intergenic
1057015833 9:91650521-91650543 ACATAATTCATTAAAGTTGCAGG + Intronic
1058297041 9:103322151-103322173 TCTTCATTTATGGAAGTTGGAGG - Intergenic
1058404086 9:104652219-104652241 TATTCATTAATTAATGCTGGTGG - Intergenic
1059741171 9:117151398-117151420 TCTTCATTCAATACCGTTAGTGG + Intronic
1061680313 9:132239783-132239805 TCCTCATTCATCAAATTGGGAGG + Intronic
1188333673 X:28901679-28901701 ACTACATTCATGAAAGTTTGAGG + Intronic
1188464749 X:30467286-30467308 TCTTCAGTCATGAAAGTTCAAGG - Intergenic
1193298438 X:79859495-79859517 TCTTCAATTATTAATTTTGGTGG + Intergenic
1195916437 X:109940836-109940858 TCTTAGTACATTAAAGTTGGGGG + Intergenic
1196421386 X:115525601-115525623 TCCTCATTTAGTAAAGTAGGTGG - Intergenic
1196622853 X:117843372-117843394 TATACATTCAGTAAAGTTGCAGG - Intergenic
1197251244 X:124218272-124218294 TGTTCATTAATTAAAGGGGGGGG + Intronic
1198675820 X:139129004-139129026 CCTTCATTCAATAAATGTGGTGG + Intronic
1199272106 X:145896420-145896442 TCTATATTCATGAAAGTTGTTGG + Intergenic