ID: 1086726694

View in Genome Browser
Species Human (GRCh38)
Location 11:90194967-90194989
Sequence CTACCACATCATTTCGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086726694_1086726701 19 Left 1086726694 11:90194967-90194989 CCACTACCGAAATGATGTGGTAG No data
Right 1086726701 11:90195009-90195031 GTGCAGTAACTAGGAAAAAATGG No data
1086726694_1086726698 10 Left 1086726694 11:90194967-90194989 CCACTACCGAAATGATGTGGTAG No data
Right 1086726698 11:90195000-90195022 CGCTCCCAGGTGCAGTAACTAGG No data
1086726694_1086726697 -3 Left 1086726694 11:90194967-90194989 CCACTACCGAAATGATGTGGTAG No data
Right 1086726697 11:90194987-90195009 TAGTACTGGCAGTCGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086726694 Original CRISPR CTACCACATCATTTCGGTAG TGG (reversed) Intergenic
No off target data available for this crispr