ID: 1086726701

View in Genome Browser
Species Human (GRCh38)
Location 11:90195009-90195031
Sequence GTGCAGTAACTAGGAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086726694_1086726701 19 Left 1086726694 11:90194967-90194989 CCACTACCGAAATGATGTGGTAG No data
Right 1086726701 11:90195009-90195031 GTGCAGTAACTAGGAAAAAATGG No data
1086726692_1086726701 22 Left 1086726692 11:90194964-90194986 CCTCCACTACCGAAATGATGTGG No data
Right 1086726701 11:90195009-90195031 GTGCAGTAACTAGGAAAAAATGG No data
1086726695_1086726701 13 Left 1086726695 11:90194973-90194995 CCGAAATGATGTGGTAGTACTGG No data
Right 1086726701 11:90195009-90195031 GTGCAGTAACTAGGAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086726701 Original CRISPR GTGCAGTAACTAGGAAAAAA TGG Intergenic
No off target data available for this crispr