ID: 1086728777

View in Genome Browser
Species Human (GRCh38)
Location 11:90222751-90222773
Sequence TGCCCCTCCTGGGCCTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 1, 2: 12, 3: 78, 4: 531}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086728777_1086728790 30 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728790 11:90222804-90222826 GGAGATCCGCGGACACCCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 69
1086728777_1086728789 19 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728789 11:90222793-90222815 GGACGGCTGCAGGAGATCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
1086728777_1086728787 9 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728787 11:90222783-90222805 GGCCGCGCGAGGACGGCTGCAGG 0: 1
1: 0
2: 3
3: 12
4: 139
1086728777_1086728784 -2 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728784 11:90222772-90222794 CATGGACCTGGGGCCGCGCGAGG 0: 1
1: 0
2: 2
3: 19
4: 184
1086728777_1086728785 2 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728785 11:90222776-90222798 GACCTGGGGCCGCGCGAGGACGG 0: 1
1: 0
2: 0
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086728777 Original CRISPR TGCCCCTCCTGGGCCTCCCT TGG (reversed) Intronic
900186547 1:1335787-1335809 TGCCCCGCATGGACCACCCTGGG + Exonic
900292003 1:1927589-1927611 AGCCCCTCCTGGACCCACCTGGG + Exonic
900308960 1:2024380-2024402 AGCCCACCCTGGGCCTTCCTGGG + Intronic
900356653 1:2268253-2268275 TGCCCCTCCAGTGCCTCCCAGGG + Intronic
900383820 1:2400059-2400081 CGCAGCTCCTGGGCCTGCCTGGG + Intronic
900393817 1:2444961-2444983 TGCCCCTCCCCGGCCTCCCATGG - Intronic
900564508 1:3325736-3325758 TGGCCCTCCTTGGACTTCCTTGG + Intronic
900564544 1:3325905-3325927 TGGCCCTCCTTGGCCCTCCTCGG + Intronic
900564582 1:3326024-3326046 TGGCCCTCCTTGGCCATCCTCGG + Intronic
900585138 1:3429007-3429029 TGGCCCTCCTTGGCCATCCTTGG - Intronic
900680243 1:3912451-3912473 TGCCCCTCCTGAGCCTGACGGGG + Intergenic
900680492 1:3913579-3913601 TGGCCTGCCTGGGCGTCCCTGGG - Intergenic
901006389 1:6173688-6173710 TGACCCTCCTGGGTCTCGCTGGG - Intronic
902604621 1:17561906-17561928 TGCCTTTGCTCGGCCTCCCTTGG - Intronic
902777244 1:18682755-18682777 GGCCCCTCCTGGGTCTGCCTGGG + Intronic
903129591 1:21270069-21270091 AGCCCATTCTGGGCCTCACTGGG + Intronic
903232045 1:21927770-21927792 TGCCCCTCCTTCGCCTACCGAGG - Intronic
903608029 1:24589305-24589327 TGCTCCTGCTGGCCCTCACTTGG + Intronic
904317291 1:29673720-29673742 TGGCCCTCCTGGGCATCCTGGGG + Intergenic
904334557 1:29788167-29788189 TTCCCCTCCCTGGCCTCCCGTGG + Intergenic
904349775 1:29897634-29897656 TGTCCCTGCTTGGCCTCCCCAGG + Intergenic
904458100 1:30659155-30659177 TCCTCCTCCTTGTCCTCCCTGGG - Intergenic
904744551 1:32702861-32702883 TGCCCCTCCCGGACCAGCCTGGG + Exonic
905473108 1:38207670-38207692 TCGCCCCCCTGGCCCTCCCTGGG - Intergenic
905629540 1:39511040-39511062 GGCCCCACCCAGGCCTCCCTGGG + Intronic
905668220 1:39775150-39775172 GGCCCCACCCAGGCCTCCCTGGG - Intronic
906148347 1:43573173-43573195 TGTTCCTCCTGGGCCTACCCCGG - Intronic
907282872 1:53362421-53362443 CGTCCCTCCTGGGCCCTCCTGGG + Intergenic
908103719 1:60818034-60818056 TCCCCCACCTCGGCCTCCCAAGG + Intergenic
909519090 1:76546684-76546706 TGTGCCTCCTGGGCCTACTTTGG - Intronic
911077651 1:93894012-93894034 TCCCCCACCTCGGCCTCCCAAGG - Intronic
911319600 1:96396465-96396487 AGCCTCTCCTGGGACTCTCTAGG - Intergenic
913363389 1:118007526-118007548 TGCTCCTCCTTGGCCTTCCAAGG + Intronic
914322980 1:146583187-146583209 TGCTCCCCCTGGGCAGCCCTGGG + Intergenic
914917512 1:151827699-151827721 TTGCCTTCCTGGGCCTTCCTGGG + Intronic
915321979 1:155061313-155061335 GGCCCCTGCTGGCCCCCCCTGGG + Intronic
915360556 1:155284156-155284178 TGCCTTTCCTGGGCCTTCTTAGG + Intronic
915521100 1:156444543-156444565 TGCCCCTCCTGGGCAGCCCCTGG + Intergenic
916499773 1:165376637-165376659 GCTCCCTCCTTGGCCTCCCTTGG + Intergenic
917121930 1:171652262-171652284 AGCCCCTCCTGGGTCTCCTGGGG + Exonic
917961882 1:180152119-180152141 TGCCCTTCCTGGAACTTCCTGGG - Intergenic
919459381 1:197858162-197858184 TGCCCCTCCAGAGCAGCCCTGGG - Intergenic
919826456 1:201506867-201506889 TCCCCATCCCGGGCCTTCCTGGG - Intronic
920014443 1:202895146-202895168 TGACCCACCTCGGCCTCCCAAGG - Intronic
920364435 1:205440614-205440636 TTTCACTCCTTGGCCTCCCTGGG + Intronic
920370772 1:205477919-205477941 TCCCCTGACTGGGCCTCCCTTGG + Intergenic
921593899 1:217034446-217034468 TGCCACTCCTGGGTCTAGCTCGG + Intronic
923083247 1:230680423-230680445 TGCACCTCCTGGAGCTCCCATGG + Intronic
923327892 1:232897067-232897089 TGCCCCACCTAGGCCTAGCTGGG + Intergenic
923334969 1:232960263-232960285 TGGCCCTCCTGAGCCTCTCCTGG - Intronic
923629756 1:235642188-235642210 CGCCCCTGCCGGGCCTCGCTCGG - Intronic
923769321 1:236924161-236924183 TGCTCCTCCTGGCCTTTCCTTGG + Intergenic
924541742 1:244987004-244987026 TGCCACTCTTGTGCCTCCGTAGG + Intronic
924656967 1:245981310-245981332 TGCCACTGCTGGGTGTCCCTTGG + Intronic
924927146 1:248694053-248694075 TGCCCCTCCAGTGCCTGGCTGGG - Intergenic
1062931335 10:1354641-1354663 GGGCCCTCCTGGGCATCCTTGGG + Intronic
1062961644 10:1576988-1577010 TGCACCTGCTGAGCCTCCCCGGG - Intronic
1063283287 10:4655103-4655125 TCACCCTCCTTGGGCTCCCTAGG - Intergenic
1063304176 10:4881147-4881169 TGCCCCACCTGGGCCTCACTCGG - Intergenic
1064359988 10:14655780-14655802 TAACCCTCCTGGGGATCCCTGGG + Intronic
1064798248 10:19038652-19038674 TGCTCCTCCTTTGCCTGCCTTGG + Intergenic
1064999089 10:21320890-21320912 CGGCCCTCCTCGGCCTCCCAGGG - Intergenic
1066065329 10:31757470-31757492 TGCTCCCCCTTGGCCTGCCTGGG + Intergenic
1067691251 10:48503756-48503778 TGCCCCTTCCGGGCCTCCTGGGG + Intronic
1068693777 10:59944282-59944304 AGCCCCTCCTTGGACTCCCTTGG - Intergenic
1069572778 10:69504520-69504542 TGCTCTTCCTGGTCCACCCTGGG + Intronic
1069634580 10:69917511-69917533 GCCTCCTCCTGGGCATCCCTGGG + Intronic
1069732028 10:70623094-70623116 TGCCTCTTCTGGGCCTCCCATGG + Intergenic
1069827433 10:71262755-71262777 TGAACCCCCTGGGCCTCACTTGG + Intronic
1069922302 10:71823556-71823578 GGCACCTCCTGGGCCACCCATGG + Intronic
1070308031 10:75251398-75251420 CACCCCTCCTTGGCCTCCCAAGG - Intergenic
1070890829 10:79941356-79941378 TGCCCCAGCGGGGCTTCCCTGGG + Intronic
1071509509 10:86252344-86252366 TGGGCCTCCTGGGACTCCCCAGG + Intronic
1072457721 10:95591347-95591369 TGGCCATCCTGGACCTCCTTGGG - Intergenic
1072909346 10:99485864-99485886 TGCCCCTTCTGGCTCTCTCTTGG - Intergenic
1072925600 10:99613816-99613838 GCCCCCTCATGGGCCTCCATAGG + Exonic
1073450011 10:103603605-103603627 GGGCCCTCCTCGGCCTCCTTGGG + Exonic
1073485924 10:103819268-103819290 TGCCTCTCCTGGGGTTCCCTGGG - Intronic
1074905300 10:117857299-117857321 ATGCCCTCCTGTGCCTCCCTGGG - Intergenic
1074981984 10:118627184-118627206 TCCCACTCCTGGGCCTCCCCAGG + Intergenic
1074990819 10:118704950-118704972 TGCCCCACCCGGGCCTTGCTCGG - Intronic
1075414867 10:122255267-122255289 TGGCTCTCCTTGGCGTCCCTTGG + Intergenic
1075574658 10:123569897-123569919 GGCCCCACATGAGCCTCCCTTGG - Intergenic
1075630926 10:124000232-124000254 TGGCCCTCGAGGCCCTCCCTGGG - Intergenic
1075724248 10:124603515-124603537 TCCTCATCCTGGGCCTCTCTGGG - Intronic
1075999468 10:126904143-126904165 TGCCCCACCTGGTCCTCCCCAGG + Intergenic
1076549774 10:131270971-131270993 AGACTCTCCTGGGCCTCACTAGG + Intronic
1076793439 10:132788066-132788088 TGCGCCCCCCGGTCCTCCCTGGG + Intergenic
1077001327 11:324242-324264 TTCCCCTCCTGGGGATCCCAAGG - Intronic
1077161272 11:1113694-1113716 GGGTCCTCCTGGGTCTCCCTAGG + Intergenic
1077235486 11:1480173-1480195 TGCACCTTCTGGGCCCCACTGGG + Intronic
1077302892 11:1855302-1855324 TGCCCAGCCTGGGCCTTCCTGGG - Intronic
1077402133 11:2364167-2364189 GTCTCCTCCTGGGCTTCCCTGGG + Intergenic
1077502844 11:2917050-2917072 GGTCCCTCCTGGTCCTCCCCAGG - Intronic
1077637655 11:3854936-3854958 TGGCCCTCGTGGGCCTCCCCCGG + Intronic
1078919515 11:15816490-15816512 TGCCCCTCCACTCCCTCCCTAGG - Intergenic
1079505491 11:21148011-21148033 TATCCCTCTTGGGCCTCCCTGGG + Intronic
1080347010 11:31336292-31336314 GCACCCTCCTGGGTCTCCCTGGG - Intronic
1080407661 11:31994213-31994235 TCTCCCTCCTCGGCCTCCCAAGG - Intronic
1080642288 11:34165003-34165025 TGCCCCTGCTCCCCCTCCCTGGG + Intronic
1082261403 11:50078297-50078319 TGCCTCTCATCGGCCTCCCAAGG - Intergenic
1082763987 11:57152036-57152058 TGGTCCTCCTTGGCTTCCCTAGG + Intergenic
1083260220 11:61518598-61518620 TCGGCCCCCTGGGCCTCCCTTGG + Exonic
1083678730 11:64341738-64341760 TGCCCCTGCTGCCCCTACCTGGG - Exonic
1083693882 11:64429737-64429759 TGCCCTGCCTGGGCTGCCCTTGG - Intergenic
1083729653 11:64645888-64645910 TGCGCCCCCAGGGCCTCCCACGG + Intronic
1084471241 11:69360509-69360531 TGCCCCTGCTGGGTCCCTCTTGG + Intronic
1084548364 11:69825784-69825806 AGCTCCTCCTGGCCCACCCTTGG + Intergenic
1084735456 11:71102668-71102690 TCCCCGACCTGGGCCTGCCTGGG + Intronic
1084837362 11:71812785-71812807 TGCCCTTCCTGGGACTTCCTGGG - Intergenic
1085054280 11:73394847-73394869 TGCCCTTATTGGGCCTCTCTGGG + Intronic
1085254666 11:75165636-75165658 TCCCTCTCCTGGGTCCCCCTCGG - Intronic
1085446154 11:76602579-76602601 CTCCCCTCCTGGGCCTCCTGGGG + Intergenic
1085478794 11:76805191-76805213 TTCCCCTCTTGGGAGTCCCTTGG - Intergenic
1085690246 11:78658460-78658482 TGGCCATCCTGGGCCTCAGTGGG - Exonic
1086306287 11:85484242-85484264 CGCCCCTCCTCCTCCTCCCTAGG + Intronic
1086459460 11:86991827-86991849 TGACCCGCTTGGGCCTCCCAAGG + Intergenic
1086728777 11:90222751-90222773 TGCCCCTCCTGGGCCTCCCTTGG - Intronic
1087674033 11:101138480-101138502 TGACCTTCCTGGTGCTCCCTCGG + Intergenic
1088740419 11:112762465-112762487 TGACCCTCCTGGTCTTACCTGGG - Intergenic
1088813451 11:113406561-113406583 TCCCTCTCCTGCGCCTCTCTGGG + Intergenic
1089065057 11:115656436-115656458 TCCCCCTCCTGGGAGTCTCTAGG + Intergenic
1089119819 11:116125638-116125660 TGGCCCTCCTTGTCCACCCTGGG + Intergenic
1091200149 11:133772503-133772525 TGTCTCTCTTGGGCTTCCCTGGG - Intergenic
1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG + Intronic
1091745632 12:2990939-2990961 TCTCCCTCCTTGGCCTCCCATGG - Intronic
1092233361 12:6790589-6790611 AGCCCCTCCTGGGCCTGGCAGGG + Intronic
1092401335 12:8181294-8181316 TGCCCTTCCTGGGACTTCCTGGG + Intronic
1095300512 12:40579385-40579407 TTTCCCACCTGGGCCTCCCAAGG - Intergenic
1095550760 12:43436231-43436253 TTCCATTCCTGGGCCTCTCTTGG - Intronic
1095596131 12:43960274-43960296 CCCCTCTCCAGGGCCTCCCTGGG - Intronic
1095824656 12:46518480-46518502 TGGGCCTCCTGGGACTCCCCTGG - Intergenic
1097031651 12:56094213-56094235 TGCCCCTTCTCTGTCTCCCTTGG - Intronic
1100104715 12:91156160-91156182 TGCCTCTCCTGGGAATCCCTTGG + Intronic
1100855327 12:98752654-98752676 TGCTCCTCCTGGGGCTAACTGGG - Intronic
1101880580 12:108623100-108623122 TCCCCCTCACGGTCCTCCCTGGG + Exonic
1102276891 12:111589387-111589409 TTGCCCTCCTTGGCCTCCCAAGG - Intronic
1102780618 12:115561451-115561473 TGCACCCCCTGCTCCTCCCTGGG - Intergenic
1104736064 12:131136615-131136637 TGGCCCTCCCAGCCCTCCCTGGG + Intronic
1104814172 12:131636529-131636551 GTCCCCTCCTGGGTCTCCCGCGG - Intergenic
1104860839 12:131922592-131922614 AACCCCGCCTGGGCCTCCCTTGG + Exonic
1105479130 13:20757110-20757132 CACCCCTCCTGGGCCTTGCTCGG - Intronic
1105693468 13:22864798-22864820 TGCCCTCCGTGGGCCTCCATTGG + Intergenic
1106317444 13:28607260-28607282 TGCCCATCCCGGGCCCCCCAGGG + Intergenic
1106629232 13:31452943-31452965 TGCCCCTCCCAGGCCTTGCTTGG - Intergenic
1107305249 13:39012161-39012183 TGTCCCTCCCGGGTATCCCTGGG - Exonic
1107555236 13:41512321-41512343 TGCCCTTTCTTGGGCTCCCTTGG + Intergenic
1107655651 13:42590007-42590029 TGCCCCTCCTGGGCCCACACGGG + Intronic
1115027183 14:28759196-28759218 TGGGCCTCCTGGGCCCCCCGCGG - Intergenic
1116080812 14:40168730-40168752 CGCCCCACCTGGGCCTCGCTTGG - Intergenic
1116574655 14:46557591-46557613 TGCCCCTCCTGCCCCACCCAAGG - Intergenic
1116902218 14:50372023-50372045 TGGCCTCCCTTGGCCTCCCTTGG - Intronic
1116902223 14:50372033-50372055 TCCCCTTCCTTGGCCTCCCTTGG - Intronic
1117195089 14:53331778-53331800 AGCCCCTCCTTTGCCCCCCTGGG - Intergenic
1117265918 14:54086612-54086634 TGCCCCTCCTGTCTCTCCTTGGG + Intergenic
1117570864 14:57047829-57047851 TGCCCCTACACGGCCTTCCTTGG + Intergenic
1118431198 14:65720379-65720401 TGGCACTCCTGGACCTGCCTGGG - Intronic
1119180298 14:72600756-72600778 TGGCCCTCCTGTGACTCCCTTGG - Intergenic
1119418936 14:74494413-74494435 TGTCCCTCCTGTACCTCCTTTGG - Intronic
1119535054 14:75396114-75396136 CACCCTTCCTGGGCTTCCCTGGG + Intergenic
1120183746 14:81371134-81371156 TGCCCTTCCTTTGACTCCCTGGG - Exonic
1121422350 14:93824600-93824622 CTCCCCTGCTGGGGCTCCCTGGG - Intergenic
1122177230 14:99929972-99929994 TGGCCCTCCTGGGCCTTCCCAGG + Intronic
1122523474 14:102363178-102363200 AGCCCCTCCTCGGCCTCCCCCGG + Intronic
1122625843 14:103085019-103085041 TGCCCCTCCTAGCCCTCCCTGGG + Intergenic
1122775178 14:104113840-104113862 AGCCCCTCATGGGCCTCACCAGG - Exonic
1123006959 14:105328369-105328391 TGCCTCCTCTGGGCCTTCCTGGG + Intronic
1123018458 14:105386575-105386597 GGCCCCTGCTGGTCCTCCCATGG + Intronic
1123124989 14:105940154-105940176 TGCCCGTGCTGGGCCTCCCATGG - Intergenic
1123442853 15:20303471-20303493 TGCCTGTCCTGGCCCTGCCTTGG + Intergenic
1123587644 15:21773388-21773410 CCCCCCACCTGGGCCTCCCAAGG - Intergenic
1123624282 15:22215953-22215975 CCCCCCACCTGGGCCTCCCAAGG - Intergenic
1124206258 15:27723598-27723620 CGCCCCTCTTGCTCCTCCCTGGG - Intergenic
1125605553 15:40937949-40937971 GGCCCTCCCTGGGCCTCCCTGGG - Intronic
1128228578 15:66019466-66019488 GGCCCCTCCTGCGGCTGCCTTGG + Intronic
1128496314 15:68200511-68200533 TGGCCTTCCTGGGCCTCCCAGGG - Intronic
1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG + Intronic
1129105752 15:73306086-73306108 TATCCCTCCTGTGCGTCCCTAGG + Intergenic
1129718849 15:77866801-77866823 TGCCCAGCAGGGGCCTCCCTGGG + Intergenic
1130460080 15:84154059-84154081 TGCCCAGCAGGGGCCTCCCTGGG - Intergenic
1131265083 15:90910965-90910987 AGCCCCTCCTGGGTCTGCATGGG + Intronic
1131826103 15:96323333-96323355 TGGCCCTCCTGGCCTTCCCCGGG + Intergenic
1132111127 15:99103050-99103072 TGCCGGTCCTGGGCCCCTCTGGG - Intronic
1132179663 15:99742704-99742726 TGGCCTTCCTGGGCATACCTGGG + Intergenic
1132478380 16:153718-153740 TGCCCCTCCCAGGCTGCCCTGGG - Intronic
1132480465 16:164308-164330 TGCCCCTCCCAGGCTGCCCTGGG - Intronic
1132496060 16:264059-264081 TAGCCCTCCCGAGCCTCCCTGGG + Exonic
1132502652 16:291456-291478 GTCCCCTCCTAGGCCTGCCTTGG + Intronic
1132807792 16:1783060-1783082 AGCCGCTCCAGGGCCTCGCTTGG + Intronic
1133234820 16:4382835-4382857 TGCCACTCATGGGCTTCCCAGGG + Exonic
1133236384 16:4389221-4389243 TGCCTCTCCTGGCCCTCCCGAGG + Intronic
1133271119 16:4611281-4611303 TTCCCCACCTGAGCCTCCCTCGG + Intronic
1133324747 16:4936153-4936175 TTCCCCTCCCAGGCCGCCCTGGG + Intronic
1133970925 16:10567560-10567582 TGAGCTTCCTGGCCCTCCCTGGG - Intronic
1134482817 16:14633308-14633330 ACTCCCTCCTGGGGCTCCCTAGG + Intronic
1135421904 16:22310700-22310722 TGGAACTCCTGGGCCTGCCTCGG - Intronic
1135683315 16:24477560-24477582 CCTCCCTCCTGGGCCTCCCAAGG + Intergenic
1135989426 16:27208703-27208725 GGCCCATCCCTGGCCTCCCTGGG - Intronic
1136621013 16:31428257-31428279 TGCTCCTCCGTGGCCTCCTTTGG + Exonic
1136684563 16:31986606-31986628 TGCCTGCCCTGGGCCTCCCAGGG + Intergenic
1137523386 16:49212703-49212725 TGCCCCTCAGAGGCCACCCTGGG + Intergenic
1137592729 16:49703673-49703695 CACCCTTGCTGGGCCTCCCTGGG - Intronic
1138459763 16:57141226-57141248 TGCCCTTCCTGGCCTTTCCTGGG - Intronic
1138475213 16:57266577-57266599 TGCCCCTCCCTCACCTCCCTGGG - Intronic
1138710896 16:58969604-58969626 TGCCCCACCTGGGCCTTGCTCGG + Intergenic
1139392181 16:66612015-66612037 AGCCCCTCCGGAGTCTCCCTGGG - Intronic
1139648848 16:68351637-68351659 TGCCCCTGCTGCCCCTCCCTCGG + Intronic
1139682387 16:68575146-68575168 GTCCCCACCTGGGCCTCCCTTGG + Intronic
1140664002 16:77212461-77212483 TCCCCGGCCTGTGCCTCCCTCGG + Intronic
1140878235 16:79173219-79173241 CTCCCCTCCTGGGCCTCCTGAGG + Intronic
1141350505 16:83290504-83290526 TGCCCCTCCTTTGCCTTCCACGG + Intronic
1141426921 16:83950062-83950084 TTCCCCTCCTCTGCTTCCCTGGG - Intronic
1141620068 16:85232577-85232599 TGGGTCTGCTGGGCCTCCCTTGG - Intergenic
1141819439 16:86434819-86434841 AGCCCCTCCTAGGACTCCCTCGG - Intergenic
1141922824 16:87147335-87147357 TGGCCATCCTGGGACTTCCTTGG - Intronic
1141923677 16:87153292-87153314 TTGCCCTCCTGGATCTCCCTTGG + Intronic
1142128392 16:88421319-88421341 TGCTCCTCCGGGGTCTCCCTGGG + Intergenic
1142610578 17:1107579-1107601 TGGCCCTCATGGGCCTCCTCTGG - Intronic
1142851610 17:2707374-2707396 TGCCCTTCCTGGGGCTGCCATGG - Intronic
1143020841 17:3916549-3916571 TGCCCCTCCTGGCTCTGCGTGGG + Intergenic
1143482588 17:7236209-7236231 CCCACCTCCTGGGCCTCCCCAGG - Exonic
1144798121 17:17906370-17906392 TGGCCCACCTTGGCCTCCCAAGG + Intronic
1145249409 17:21289217-21289239 CTGGCCTCCTGGGCCTCCCTTGG + Intronic
1145258782 17:21342533-21342555 GCCACCTCCTGGGCCTCTCTGGG + Intergenic
1145317842 17:21745471-21745493 GCCACCTCCTGGGCCTCTCTGGG - Intergenic
1145784731 17:27586498-27586520 TGCTCCCCCTGTGCCTCCCTGGG - Intronic
1146581220 17:34040173-34040195 GGGCCCTCCTGCGCCTCCCTTGG - Intronic
1146671605 17:34741783-34741805 ATCCCCTTCTGGGCCTCCCATGG - Intergenic
1146933146 17:36792333-36792355 TGCCCCCCCAGGGACGCCCTGGG + Intergenic
1147978837 17:44262571-44262593 TGCCCCTCCTGTCCCTGTCTAGG + Intronic
1148081015 17:44967793-44967815 CGGCCCTCCGGGGCCTCCCGGGG - Exonic
1149986565 17:61352216-61352238 GGCCCCTCCTGGGAGCCCCTTGG + Intronic
1150108540 17:62478964-62478986 GGGCCCTCCTGCGCCTCCCTTGG + Intronic
1150837410 17:68576870-68576892 TGTCCCTCCTGGCCTGCCCTAGG - Intronic
1151010070 17:70483959-70483981 AGCCCCTTCAGGCCCTCCCTGGG + Intergenic
1151403091 17:73868913-73868935 TGCCTCAGCAGGGCCTCCCTGGG - Intergenic
1151570948 17:74925054-74925076 CGGTCCTCCTGGTCCTCCCTAGG - Intronic
1151671576 17:75574165-75574187 CGCCCCGCCTGGGCCCTCCTCGG - Intronic
1151691861 17:75691512-75691534 TGCCACTTCAGGGCCTCCTTAGG - Intronic
1151696688 17:75721559-75721581 CGCCCGTCCTGGACCTACCTCGG - Exonic
1152155580 17:78630514-78630536 TGGCCATCCTGGGCGTCCTTTGG - Intergenic
1152162484 17:78677452-78677474 TGCCCCACCTCCACCTCCCTGGG + Intronic
1152354680 17:79801056-79801078 GGGCCCTCTTAGGCCTCCCTGGG + Intronic
1152556454 17:81055467-81055489 TGCCCCTCCTCTACATCCCTGGG + Intronic
1152633327 17:81420418-81420440 TCCCGCTGCTGGGCCACCCTGGG + Intronic
1152648182 17:81479910-81479932 TCCCCCTCCTGAGCCTCTCAGGG + Intergenic
1152900989 17:82941094-82941116 AGCCCCTCCTTGGCCTCGCTTGG + Intronic
1153248247 18:3094900-3094922 TGATCCTCCTTGGCCTCCCAAGG + Intronic
1155788334 18:29931273-29931295 TGTCACTCCTGTGCCTCCCTGGG - Intergenic
1156449595 18:37259405-37259427 TGCCTCTTCTGGGGCGCCCTTGG - Intronic
1157649408 18:49312736-49312758 TGCCCCGCCTGGGTCTTGCTTGG - Intronic
1159431944 18:68363163-68363185 TGTCCCTCCTGGGCCTCGTTTGG - Intergenic
1160135087 18:76264858-76264880 TGTTTCTCCTGGGCCTCCATGGG - Intergenic
1160580740 18:79883533-79883555 TGCCCCGCCTGGACCACCCTGGG + Intronic
1160878922 19:1310849-1310871 GGCCCCACGGGGGCCTCCCTGGG - Intergenic
1160923152 19:1529888-1529910 TTCCCATCCTGGGCCCTCCTGGG + Intronic
1161100031 19:2416861-2416883 TGCCCATCCTGACCCTCCCCAGG - Intronic
1161153236 19:2720454-2720476 AGCCCCTCCTGCTCCTGCCTCGG - Intronic
1161240271 19:3219186-3219208 TCCTCCTCCTTGGCCTCCTTAGG - Intergenic
1161326414 19:3666186-3666208 TGTCCCACCTGGGCCACCCTTGG - Intronic
1161346522 19:3771160-3771182 CTCCCCTCCTTGGCCTCCCTTGG + Intronic
1161449763 19:4338608-4338630 TGGCCCTGCTGGGCCACCGTGGG - Intronic
1161577742 19:5064185-5064207 TGGCCCTCCTGGGCTTGCGTGGG + Intronic
1161644652 19:5445655-5445677 CTCCCCTCCTGGGCCTGGCTGGG + Intergenic
1161925224 19:7294437-7294459 TCCCTCTCCTGGGCCTCTCCCGG - Intergenic
1162752057 19:12834951-12834973 TGGCCCTTCTGAGCCTCCTTGGG + Intronic
1163102729 19:15107756-15107778 GCCCCCTCCCGGGCCTCCCAAGG - Intronic
1163712398 19:18854536-18854558 TGACCTTTCTGGGCCACCCTTGG - Intronic
1164565567 19:29323686-29323708 TCGCCCTCCTGGGCCTCCGGTGG + Intergenic
1164674600 19:30092975-30092997 CGCTCTTCCTGGGCCTCTCTTGG + Intergenic
1164853280 19:31501937-31501959 AGTCCCTCCTGGGCTTCCTTAGG + Intergenic
1165050742 19:33139936-33139958 ATGACCTCCTGGGCCTCCCTGGG + Intronic
1165089040 19:33373200-33373222 TCTCCCGCCTCGGCCTCCCTCGG + Intergenic
1165144874 19:33724618-33724640 TGCCCCTCCAGGGCCTTCCGAGG - Intronic
1165157769 19:33798131-33798153 TGCCTCTCCGGGGCCACCCCTGG + Intronic
1165307544 19:35011676-35011698 TGCCCCTGCAGCTCCTCCCTGGG + Intronic
1165771910 19:38385159-38385181 TGGCCCTCCTGTACCTCTCTTGG - Intronic
1166049229 19:40248178-40248200 TGCCCTTCCTGTGCCTCGGTGGG + Intronic
1166378831 19:42344046-42344068 ACCCCCTCCTGGGACCCCCTTGG + Exonic
1166417455 19:42606670-42606692 TGCCCTTCCTCAGCTTCCCTGGG + Intronic
1166438038 19:42786182-42786204 CTCCCCTCCTGGGCCTACCCAGG + Intronic
1166553727 19:43684294-43684316 TTCTCCTCCTGCTCCTCCCTGGG - Intergenic
1167415038 19:49365552-49365574 TGGACTTCCGGGGCCTCCCTGGG + Exonic
1167479168 19:49718838-49718860 TCACCCGCCTCGGCCTCCCTAGG - Intergenic
1167995991 19:53402668-53402690 TGTCCCACCTGAGCCTCCCCTGG + Intronic
1168084396 19:54034767-54034789 AGCCCGGGCTGGGCCTCCCTGGG - Intergenic
925047050 2:780444-780466 TGCCCATCCTTGGCCTTCCCTGG + Intergenic
925181953 2:1823202-1823224 TGCCCCTGCTGGGTCTGCCTGGG - Intronic
925349099 2:3188719-3188741 TGCCCGCCCTGGGCCTCCCCTGG - Intergenic
925377937 2:3401397-3401419 TCATGCTCCTGGGCCTCCCTAGG + Intronic
925390670 2:3491862-3491884 AGGCTCTCCGGGGCCTCCCTGGG - Intergenic
925911759 2:8578356-8578378 TGGCCCTTCTGGATCTCCCTTGG - Intergenic
926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG + Intergenic
926216636 2:10909663-10909685 AGCCTCTCCTGGGCCTGCCCAGG + Intergenic
926679771 2:15654387-15654409 TGAACCCCCAGGGCCTCCCTTGG - Intergenic
926686750 2:15704099-15704121 TCCCCCTCCCCAGCCTCCCTGGG - Intronic
927812154 2:26186215-26186237 TGCCCCTCCAGTGCCTCCCCGGG + Exonic
928291033 2:30037542-30037564 TGCCCCTGCAGGCCCTCCATGGG + Intergenic
928941365 2:36730596-36730618 TGCCTCACCTGGGCCTTGCTCGG + Intronic
929037277 2:37706309-37706331 TCCTCCTCCAGGGCCTCTCTGGG + Intronic
929432853 2:41903164-41903186 TGCCCCACCTGGCCCTACCCTGG + Intergenic
929501082 2:42492698-42492720 GGCCGCGCCTGGGCCTCGCTGGG + Intronic
929570847 2:43022046-43022068 TTTCCCCTCTGGGCCTCCCTTGG + Intergenic
931073556 2:58683448-58683470 TCCCCCACCTCGGCCTCCCAAGG - Intergenic
932220558 2:69995760-69995782 TGCCCCTCCCAGGCCTCTCCAGG - Intergenic
934679345 2:96271414-96271436 TGCTCCTCCTGGTCCTCTCAGGG - Exonic
934736722 2:96693402-96693424 TGACCCTCCTGGGCCCCACTGGG + Intergenic
934764916 2:96875286-96875308 GGCCCCTCCTGACCCTTCCTGGG - Intergenic
934946214 2:98543808-98543830 TAGACCTCCTGGGCCTCTCTGGG + Intronic
934949139 2:98564483-98564505 TGCCCCACCTGGGCTTCTCAAGG + Intronic
936018943 2:108980271-108980293 TGACTCACCTGGGCCTCCCTGGG - Intronic
936458592 2:112694264-112694286 TCCGCCACCTTGGCCTCCCTAGG + Intergenic
937320497 2:120957992-120958014 TGGCCCGGCTGGCCCTCCCTTGG - Intronic
938089709 2:128423416-128423438 TCACCCTCCTCGGCCTCCCAAGG - Intergenic
938260666 2:129893003-129893025 AGCACCTCCTGGGTCTCCATGGG + Intergenic
938319793 2:130355527-130355549 TGCCCCTCCCCGGCCTCCCTTGG + Intergenic
938479421 2:131647090-131647112 AGCAGATCCTGGGCCTCCCTGGG + Intergenic
938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG + Intergenic
941518770 2:166511696-166511718 AGTCCCTCGTGTGCCTCCCTGGG - Intergenic
942208806 2:173650140-173650162 TGCTACTCCTGGGCATCCCTCGG - Intergenic
945261968 2:207851923-207851945 TCCACCTCCTGTGCATCCCTTGG - Intronic
945419409 2:209616210-209616232 TGCCCCACCTGGGCCTCACTAGG - Intronic
946174078 2:217912106-217912128 GGCCCCTCCTGGCCCCACCTTGG - Intronic
946253587 2:218428205-218428227 TGCCTCCCCTGTGGCTCCCTAGG + Exonic
947665694 2:231904185-231904207 TGCACCTGCTGGGCATCCTTGGG - Intergenic
948207295 2:236168845-236168867 TGCCCCTCCGGAGCCACCCCCGG + Intergenic
948289868 2:236816945-236816967 TGCCCTCCCTGGCCCTCTCTGGG + Intergenic
948373112 2:237503264-237503286 TTCCCCTCCAGGCCCTGCCTTGG - Intronic
948559903 2:238845911-238845933 TGCCCTTCCAGGGCGTCCCCGGG + Intergenic
948607203 2:239143746-239143768 AGCCCCTCCCCGGCTTCCCTAGG + Intronic
948670710 2:239566885-239566907 TGCTCCTCCAGGGCCAGCCTGGG - Intergenic
948791047 2:240376979-240377001 TGCCCCTGCTGGCCCCTCCTAGG - Intergenic
948804353 2:240447049-240447071 CACCCCTTCTGGGCATCCCTGGG - Intronic
948853179 2:240718241-240718263 TGCCCCTCCCCTGCCTGCCTGGG - Intronic
948897513 2:240934212-240934234 TGCTCCTCCTGGGCCTCCCTGGG + Intronic
949022942 2:241751775-241751797 TGCCCATCCTAGGACTCCCGAGG - Intronic
1169075414 20:2757096-2757118 TGCCCCACCTGCCCCTGCCTTGG - Intronic
1169091860 20:2865733-2865755 TGCCCCCTGTGGCCCTCCCTGGG - Intronic
1170766125 20:19291241-19291263 AGGCCTACCTGGGCCTCCCTGGG - Intronic
1171091847 20:22292862-22292884 TTCTCCTCCTGGGACTCCCGGGG - Intergenic
1171196138 20:23201054-23201076 CGCCACTCCTCAGCCTCCCTGGG - Intergenic
1171484639 20:25477898-25477920 TGTCCATCCTGTGCCTCCCCAGG - Intronic
1171727500 20:28638710-28638732 TGCCCCTTCATGGCCTGCCTGGG - Intergenic
1171750615 20:29044988-29045010 TGCCCCTTCATGGCCTGCCTGGG + Intergenic
1171750730 20:29045906-29045928 TGCCCCTTCATGGCCTGCCTGGG + Intergenic
1171935851 20:31274366-31274388 TGGACTTCCGGGGCCTCCCTAGG + Intergenic
1172276311 20:33681512-33681534 ACCACTTCCTGGGCCTCCCTGGG - Intronic
1172670315 20:36630501-36630523 TGCCCCACGTGGGCCTTTCTTGG + Intronic
1172913586 20:38427926-38427948 AGGCCCTACTGGGCTTCCCTGGG + Intergenic
1173058214 20:39636498-39636520 TGCCCCACCTGGGCCTCGCTTGG - Intergenic
1173813055 20:45968100-45968122 TGCACTCCCTGGGCCTGCCTGGG - Intronic
1175047258 20:56118802-56118824 TGACAATCCTGGGCCTTCCTGGG + Intergenic
1175384788 20:58587245-58587267 ACCCCATCCTGGACCTCCCTGGG + Intergenic
1175501339 20:59453184-59453206 TACCCCTCCTTGTCTTCCCTGGG + Intergenic
1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG + Intronic
1175588103 20:60162414-60162436 TGCCCCTGCTGGGTCTAGCTTGG + Intergenic
1175935883 20:62513807-62513829 GGCCCTTCCTGAGGCTCCCTGGG + Intergenic
1176091921 20:63322047-63322069 TGCCTCTGCAGGGCCTCCCTGGG + Exonic
1176128329 20:63485782-63485804 GGCCCATCCTGGGCCTCTGTGGG - Intergenic
1176211431 20:63924846-63924868 TGCCCCACCTGGGCCCTGCTTGG + Intronic
1176299442 21:5091570-5091592 TGTCCCTCCTTCCCCTCCCTGGG - Intergenic
1176314030 21:5225016-5225038 TGCCCCTTCATGGCCTGCCTGGG - Intergenic
1176372791 21:6072600-6072622 TTTTCCTCCTGCGCCTCCCTGGG + Intergenic
1176866492 21:14057417-14057439 TGCCTGTCCTGGCCCTGCCTTGG - Intergenic
1178397964 21:32259308-32259330 TGCCTCGCCTTGGCCTCCCAGGG + Intergenic
1178716412 21:34968405-34968427 TGCCCCACCTGTGGCTCCCCAGG - Intronic
1179561783 21:42219885-42219907 TGCCCCTCGCGGGTCTCCCCGGG - Intronic
1179586597 21:42377354-42377376 TGCCCCTCCTTGGTCTTCCGGGG - Intronic
1179750686 21:43465643-43465665 TTTTCCTCCTGCGCCTCCCTGGG - Intergenic
1179857584 21:44170377-44170399 TGTCCCTCCTTCCCCTCCCTGGG + Intergenic
1179889285 21:44327554-44327576 AGCCCCTCCTGGTCCTCCCCTGG + Intergenic
1180054915 21:45352738-45352760 AGCCCCTCCTCGGCCTCCTCCGG + Intergenic
1180211160 21:46296091-46296113 TGCCCCTTCAGGGCCACCCCAGG - Intronic
1180784536 22:18539465-18539487 GGCTCCTCCTTGGCCTCCTTGGG - Intergenic
1180985395 22:19901214-19901236 TGACTCTCCAGGCCCTCCCTCGG + Intronic
1180995657 22:19963966-19963988 TGCCCCTCCTGGTGCCACCTTGG - Intronic
1181128113 22:20713518-20713540 GGCTCCTCCTTGGCCTCCTTGGG - Intronic
1181161954 22:20964893-20964915 CGCCCCAGCTGGGCATCCCTGGG + Intergenic
1181182594 22:21078367-21078389 AGCCCCTCCTCACCCTCCCTTGG + Intergenic
1181241439 22:21478822-21478844 GGCTCCTCCTTGGCCTCCTTGGG - Intergenic
1181311904 22:21949475-21949497 TGCCCCTCCAGGCACTCCCAGGG - Intronic
1181441154 22:22935803-22935825 TGCTCCTCCTGGGCCACACCTGG - Intergenic
1181516107 22:23414748-23414770 TGCCCCTCCAGGACCTCCTTGGG - Intergenic
1181818902 22:25460406-25460428 TGGGCCTCCCGGGCCTCCCGTGG + Intergenic
1181947286 22:26528113-26528135 TGTCCTTCCAGAGCCTCCCTGGG - Intronic
1182429750 22:30292598-30292620 TGCTCCTTCTGGGCCTGCTTGGG + Exonic
1182548677 22:31089860-31089882 TGCCTCTCCTGAGCCTCCATTGG + Exonic
1182559364 22:31147724-31147746 TTCCCCTCCTGGGCAGCCTTGGG + Intergenic
1183110000 22:35641949-35641971 TGCCCCACCTGGGCCTCTCTTGG - Intergenic
1183363623 22:37395811-37395833 CTCCCACCCTGGGCCTCCCTTGG - Intronic
1183927042 22:41213686-41213708 TGCTGCTGCTTGGCCTCCCTTGG - Intronic
1184060170 22:42076832-42076854 TGACCCTCCTGGGCCTCTACTGG - Intronic
1184102399 22:42347713-42347735 TGCCCCTGCTGGCGCTGCCTCGG - Intergenic
1184275007 22:43405112-43405134 TCCCCCTCCTGGCCCACCATAGG - Intergenic
1184380796 22:44143811-44143833 TCCCCCTCCTGGGCCTGCCCTGG + Intronic
1184401781 22:44278727-44278749 TGCACCTCAGGGGCCTCCGTGGG + Intronic
1184617925 22:45650650-45650672 TGTCCCAGCTGGGACTCCCTAGG + Intergenic
1184649817 22:45914583-45914605 TGCCCCTACTAGGCCTCCTAGGG + Intergenic
1184987498 22:48145671-48145693 TGCCCCTCCTCTGCCACCCCAGG + Intergenic
1185059574 22:48599270-48599292 CGCCCATCCTGAGACTCCCTAGG + Intronic
1185205576 22:49535954-49535976 TCCCTCTCCTGGGGCTCGCTCGG - Intronic
1185371804 22:50464482-50464504 CGCCCATCCTGGGCCACGCTCGG + Intronic
949935012 3:9109845-9109867 TCCCTCTCCTGCTCCTCCCTGGG - Intronic
950456309 3:13094805-13094827 TGACCCTTCTGGGCCTCCACTGG + Intergenic
950707833 3:14793890-14793912 AGACCCCCCTGGGCCTCCCAGGG - Intergenic
950895831 3:16449968-16449990 TTCCCCTGCTGCGCCTCCCTGGG - Intronic
951979296 3:28548061-28548083 TGGCCCTTCTGGGCTACCCTTGG + Intergenic
952270357 3:31825006-31825028 TGCCCCTTCTTGTCCTCACTGGG - Intronic
953069974 3:39509845-39509867 TGACCCTGCTGGGGGTCCCTGGG - Intronic
953138502 3:40205083-40205105 AGCCCCCCTTCGGCCTCCCTTGG + Intronic
953982278 3:47418775-47418797 CGGCCCTCCAGAGCCTCCCTCGG + Exonic
954461112 3:50627589-50627611 CCCCTCTCCTGGGCCTGCCTAGG - Intronic
954604044 3:51895008-51895030 TGCCGCTCCTGTGCTTCCCGGGG - Exonic
954652406 3:52173235-52173257 TGCCCCCCCATGGCCTCACTGGG - Intergenic
954687008 3:52376563-52376585 GCCTCCTCCTGGGCCTGCCTGGG + Intronic
954702456 3:52457438-52457460 TGGCCCTGCTCTGCCTCCCTTGG + Intronic
954976497 3:54700017-54700039 TGTCCCTCCTGGGTTTCCTTAGG + Intronic
955922604 3:63973572-63973594 CGCCCTGCTTGGGCCTCCCTCGG + Intronic
958449887 3:94259909-94259931 TGCCCCACCTGGGCCTCACACGG - Intergenic
959835747 3:110916713-110916735 TGCCCCTGCTGGGGGTGCCTCGG + Intergenic
960963005 3:123085086-123085108 CGACCCTTCTGGGCCTCCCAAGG + Intronic
961368858 3:126417701-126417723 GGCCCTGGCTGGGCCTCCCTGGG - Intronic
961398564 3:126616546-126616568 TGCTCCTCCTTGGCCTAACTTGG - Intronic
961633086 3:128315569-128315591 CCTCCCTCCTGGGCCTCCCCAGG - Intronic
961660899 3:128468324-128468346 TGCCCTCTCTGGGCCTCGCTTGG - Intergenic
964765064 3:160171630-160171652 TGCCCCTCCTGCCCCTACCTTGG + Intergenic
964906787 3:161726835-161726857 TACCCCTTCTCCGCCTCCCTGGG - Intergenic
965561055 3:170062750-170062772 TGCCCTTCCTGGAGCTCCTTGGG - Intronic
967439031 3:189485602-189485624 TTCCTCTCCTGGGACTGCCTGGG + Intergenic
968450860 4:675321-675343 TGCCCGTGCTGGGCCACCCTCGG + Intronic
968480881 4:832594-832616 TGCCCTTCCTGGCCCCACCTGGG - Intergenic
968633877 4:1667758-1667780 TGCCTATCCTGGGCCTGGCTTGG - Intronic
968978763 4:3835540-3835562 TGGGCCTCCTGGGCCTCCTGGGG + Intergenic
969035280 4:4248437-4248459 TGGTCCTCCTGGGCTTCCGTAGG - Intergenic
969075805 4:4576709-4576731 AGTCCCTGCTGGGCATCCCTGGG - Intergenic
969117177 4:4877986-4878008 CATGCCTCCTGGGCCTCCCTGGG - Intergenic
969227442 4:5808084-5808106 GGCCCCTCTTGGGGCTCCCAGGG + Intronic
969394429 4:6910862-6910884 TGCCCCTACTGGAGGTCCCTGGG + Intronic
969778772 4:9380276-9380298 TGCCCTTCCTGGGACTTCCTGGG - Intergenic
969877967 4:10149923-10149945 TGCGCCTCCTGGGGACCCCTGGG + Intergenic
970993455 4:22238650-22238672 TTCCCCACCTGGGCCACCTTGGG - Intergenic
973293438 4:48491081-48491103 TCGCCCTCCTGGGCCTCTCGCGG - Exonic
976392801 4:84523217-84523239 TGCCCCTCCTTACCCTCCCCAGG - Intergenic
977403759 4:96569548-96569570 TTGCCCTCATGAGCCTCCCTTGG - Intergenic
979547021 4:121951048-121951070 TCCCCTTCCTCGGCCTCCCTGGG + Intronic
980223383 4:129948289-129948311 TGCCCCTGCTTGCCCTCCGTGGG + Intergenic
981050201 4:140302075-140302097 TGGCCTCCCTGGGCCTCCCAAGG + Intronic
983692014 4:170482055-170482077 TGCCCCAGCTGTGCTTCCCTGGG - Intergenic
985433093 4:189900336-189900358 TGCCCCTTCATGGCCTGCCTGGG + Intergenic
985517437 5:354248-354270 TCCCCGTGCTGGGCCTCACTGGG + Intronic
985705838 5:1400882-1400904 GGTCCCTGCTGGGCCTCTCTCGG - Intronic
985772568 5:1822048-1822070 TGGCCCTCCTTGGCGTTCCTCGG + Intergenic
986141958 5:5039465-5039487 TGCACCTCCTGTGCCTCTGTGGG + Intergenic
986707799 5:10465915-10465937 TACCCCTCCTAAGACTCCCTGGG + Intronic
988553259 5:32215885-32215907 TGCTCCTTCTCGGCCTCCCTGGG - Intergenic
991510754 5:67374264-67374286 TTCCCTTCCTGGGACTTCCTGGG - Intergenic
992143271 5:73820434-73820456 TGCACCTCCTGGGTCCTCCTAGG + Intronic
995713216 5:115055369-115055391 TGCCACTGCTGTGTCTCCCTTGG - Intergenic
997359895 5:133288395-133288417 TGCCCCTCCCAGGCCTGTCTGGG + Intronic
997709381 5:135990899-135990921 CGCCCCTCATGGCCCTTCCTTGG - Intergenic
998372970 5:141672855-141672877 AGCGCCTCCTGGGCCACCCCCGG - Exonic
998642920 5:144032388-144032410 TGCAGCTCCTGGGGCTCCATGGG + Intergenic
999220367 5:149971257-149971279 TGCTCATCCTTGGCATCCCTGGG + Intronic
1001960759 5:175879147-175879169 AGCCCCTGCTGGGGCTCCCCTGG + Intronic
1002105990 5:176879643-176879665 TGCCCCCCCTGGCCCACCCCAGG - Intronic
1002446850 5:179295310-179295332 GGCTCCTCCTGGCTCTCCCTGGG + Intronic
1002781873 6:373189-373211 TGCCCCTCCAGGCCCTCGCAGGG + Intergenic
1003054171 6:2804003-2804025 AGCTCCTCCTGGGGCTACCTGGG - Intergenic
1003904612 6:10687854-10687876 TACCCCTTCTGTCCCTCCCTGGG - Intronic
1004249266 6:14009666-14009688 AGCCCCTGCTGGGCCTTTCTGGG + Intergenic
1005144698 6:22675354-22675376 TCCGCCTCCTCGGCCTCCCAAGG - Intergenic
1005947095 6:30602666-30602688 TGGCCCACCAGGGCCTCCATGGG + Exonic
1006110342 6:31740563-31740585 TCCTCCTCCTCGGCCTCCCTGGG - Exonic
1006251944 6:32795038-32795060 TGCTTCTCCTGGTCCTACCTGGG + Intergenic
1006443363 6:34065568-34065590 TGGCTTTCCTGGGTCTCCCTTGG + Intronic
1006671481 6:35732085-35732107 TCCCCGTCCCGGGCCTCCCCCGG - Intergenic
1006985136 6:38170883-38170905 TGCCCGACCTGGGCATCGCTCGG + Exonic
1008155463 6:48008737-48008759 AGCCCTTCCTGGGCCTCCTGGGG - Exonic
1013375524 6:109510161-109510183 TGCCTCTTCTGGGCCTACCCAGG + Intronic
1014724837 6:124962204-124962226 TGTCCCGCCTGGGGCTCGCTGGG + Intergenic
1015233926 6:130949356-130949378 TCTCCCTCCTTGGCCTCCCAAGG - Intronic
1015645811 6:135386872-135386894 TGGCCCACCTCGGCCTCCCAAGG + Intronic
1015985193 6:138877333-138877355 TGCTCCTCCTGGGTGTTCCTAGG - Intronic
1016250752 6:142038967-142038989 TGCCCTTCGTGGCCCTCCTTCGG - Intergenic
1016680193 6:146820419-146820441 TGCCCTACCTGGGCCGCTCTCGG + Intergenic
1018013567 6:159693241-159693263 TGCCGCTCCTGCGCCGCCCGCGG + Exonic
1018927343 6:168215415-168215437 TGCCCCTCCAGGGAAGCCCTGGG + Intergenic
1018984773 6:168628084-168628106 TTGCCTTCCTTGGCCTCCCTGGG + Intronic
1018998048 6:168725074-168725096 AGCAGCTCCTGAGCCTCCCTGGG + Intergenic
1018998429 6:168727553-168727575 AGCCCCTCCAGCGCCTCTCTCGG - Intergenic
1019104378 6:169656642-169656664 TCCTCCTCCTGGGCCCTCCTGGG - Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019436677 7:1025808-1025830 TGCCTCCCCTGGGCCTCCAGAGG + Intronic
1019501332 7:1366333-1366355 GGACCCTCCTGGGCCTCAGTCGG - Intergenic
1019570208 7:1707931-1707953 GGCCCCTCCTGGCCCCCACTAGG + Intronic
1019588572 7:1817566-1817588 TGCCCCTCCAGGACATCCCCTGG - Intronic
1019623962 7:2006376-2006398 TGCCTGTCCTGGGCCTCCCCAGG + Intronic
1019729740 7:2623339-2623361 AGCCCCTCCCTGGCCTCCCAGGG - Intergenic
1020021806 7:4873745-4873767 CGCCTGTCCTGCGCCTCCCTGGG - Intronic
1020104866 7:5418061-5418083 TACCCCTCCAGGGCCAGCCTAGG + Intronic
1020178111 7:5898833-5898855 TGCTTCTCCTGGGCCGCCCAGGG - Exonic
1020304816 7:6826142-6826164 TGCTTCTCCTGGGCCGCCCAGGG + Exonic
1022293653 7:29028719-29028741 TGCCCCACCTTGGCCTCCCCAGG - Intronic
1022487533 7:30791297-30791319 TCCCCCTCCAGGACCTCCCTGGG + Exonic
1022532664 7:31076719-31076741 GTCCCCTGCTGGGCCTGCCTTGG + Intronic
1023055148 7:36284959-36284981 TGTCTCTCCTGGGGCTTCCTTGG + Intronic
1023255725 7:38310661-38310683 TGCCCATCCAGGCCCTCCCTGGG + Intergenic
1023401107 7:39793375-39793397 TGCCCCACCGCGGCCTCCCGGGG - Intergenic
1024233995 7:47384245-47384267 TGCCCCTCCAGAGACCCCCTGGG - Intronic
1025182912 7:56832710-56832732 TGCCACTCATTGGCCTCCCAAGG - Intergenic
1025250859 7:57350473-57350495 TGCCCCTGCTGTCCCTCACTGGG + Intergenic
1025689014 7:63744264-63744286 TGCCACTCATTGGCCTCCCAAGG + Intergenic
1026045589 7:66903760-66903782 TGCCTCACGTTGGCCTCCCTGGG + Intergenic
1026552866 7:71382602-71382624 TGGTCCTCCTGGGCATCCCTGGG + Intronic
1026964697 7:74431635-74431657 TCCCCCACCTTGGCCTCCCAAGG - Intergenic
1027269495 7:76512063-76512085 TGCTCCTCCTGGGCCTTGCCCGG - Intronic
1027632374 7:80622308-80622330 TGCCCCACCTGGGCCTCTCTTGG - Intronic
1028000685 7:85494444-85494466 TGCTCTGCCTGGGCCTCACTTGG + Intergenic
1029931776 7:104379305-104379327 TGCACTTCTTGGGCCTCCCTCGG + Intronic
1032037576 7:128531505-128531527 GGGCCCTTCTGCGCCTCCCTTGG + Intergenic
1032086819 7:128888816-128888838 TCCCCCTGCTGGGGCTCCCGGGG - Intronic
1032171394 7:129587543-129587565 TCCACCCCCTCGGCCTCCCTAGG - Intergenic
1032265253 7:130366011-130366033 CGCGCTCCCTGGGCCTCCCTGGG + Intronic
1032511369 7:132475229-132475251 TGCCCCTCCCAGCCCTCCTTGGG + Intronic
1033586903 7:142780773-142780795 TGGCTCTGCTGGCCCTCCCTCGG + Intergenic
1035437160 7:158867735-158867757 GGCCTCTCCTGGGCCTCCCCGGG + Intronic
1035462275 7:159049428-159049450 GGGCCCTCCAGGGCCTCCGTGGG + Intronic
1035595324 8:853295-853317 AGCCCCTCCTGGGACTCTGTGGG - Intergenic
1035890920 8:3341654-3341676 TGCCCCTGCTATGGCTCCCTGGG - Intronic
1036202188 8:6778990-6779012 GGCCCCTCCTGTGGCTCCCCAGG + Intergenic
1036276224 8:7354249-7354271 TGCCCTTCCTGGGACTTCCTGGG - Intergenic
1036345123 8:7956098-7956120 TGCCCTTCCTGGGACTTCCTGGG + Intergenic
1036702862 8:11024713-11024735 TGGCCCTCTTGGGCCTCCCTGGG - Intronic
1036739904 8:11350530-11350552 TTCCCAACCTGGGCCTCTCTGGG - Intergenic
1036840456 8:12116865-12116887 TGCCCTTCCTGGGACTTCCTGGG + Intergenic
1036862254 8:12363110-12363132 TGCCCTTCCTGGGACTTCCTGGG + Intergenic
1037425069 8:18746498-18746520 CACCCCCCCTGGACCTCCCTTGG - Intronic
1037748268 8:21663298-21663320 TCCCCTTCCTGGCCCTCCCCAGG - Intergenic
1039566230 8:38554243-38554265 TTCCCCTCCGGAGCCTCCCGGGG + Intergenic
1039793807 8:40895854-40895876 TGCCCCTCCTGGGCTCCCTGGGG + Intronic
1040531613 8:48270871-48270893 TGCCCAGCCTGGGCCTCCACTGG - Intergenic
1040915723 8:52565160-52565182 TGCGCCCCCGGGGCCTCCCGTGG + Exonic
1040950906 8:52938560-52938582 TGCCCCTGCTAGTCCTTCCTTGG + Exonic
1041978876 8:63832100-63832122 CACCCCACCTGGCCCTCCCTTGG - Intergenic
1045211680 8:100106097-100106119 TGGCCGGCCTCGGCCTCCCTGGG - Exonic
1045770222 8:105728610-105728632 TGCCTTTCCTGTGTCTCCCTTGG - Intronic
1046314265 8:112479153-112479175 CACCCCACCTGGGCCTCACTGGG - Intronic
1047374007 8:124279021-124279043 TTCCCCTCCAGAGCCCCCCTCGG + Intergenic
1048329394 8:133461796-133461818 TCCCCCTCCCTGGCCTCTCTTGG + Intronic
1048441158 8:134459963-134459985 GGCCACTCCTTGGCCTCTCTGGG + Intergenic
1048490266 8:134885541-134885563 TGCCCGTCCTGCTCCTACCTGGG - Intergenic
1048677898 8:136805353-136805375 TCCCCTTCCTGGGCCTCCCTAGG + Intergenic
1049245720 8:141561274-141561296 TGGCCATCCAGGGCCTCCATGGG - Intergenic
1049450976 8:142661337-142661359 GGCCTCTCCTGGGCATCCCGAGG + Intronic
1049472751 8:142783645-142783667 TGACCCACCTTGGCCGCCCTGGG + Intergenic
1049570983 8:143370211-143370233 TCCCTGTCCTGGCCCTCCCTGGG + Intronic
1049591936 8:143466628-143466650 TGCCCCTCATGGGCCACCACGGG + Intronic
1049601381 8:143509413-143509435 TGCCCCACCTGGGCCAAGCTGGG + Intronic
1049621604 8:143600742-143600764 TGCCTCTCCTGGGACTGCCAAGG + Exonic
1049644137 8:143728522-143728544 GGCCTCTCGTGGGCGTCCCTGGG - Exonic
1049690229 8:143955081-143955103 TGCCCGTCCCTGCCCTCCCTGGG + Intronic
1049692026 8:143965656-143965678 AGCTCCTCTTGGGCCTCACTGGG + Intronic
1049768697 8:144368788-144368810 TGCCCCACCTGGGCCTCGCTGGG + Intergenic
1050126370 9:2360291-2360313 TGCCCCTCAAGTGACTCCCTTGG - Intergenic
1051429108 9:16964038-16964060 TTCCCTTCCTGGCCCTGCCTTGG + Intergenic
1052354270 9:27488178-27488200 TGTCCCTCCTCTGCCTCCCATGG - Intronic
1053288554 9:36865216-36865238 GGCTCACCCTGGGCCTCCCTGGG - Intronic
1053722241 9:40958388-40958410 TGCCCCTTCATGGCCTGCCTGGG + Intergenic
1054343729 9:63893606-63893628 TGCCCCTTCACGGCCTGCCTGGG - Intergenic
1056398085 9:86199782-86199804 TGCCTCTTCTGGGCCTCCCTAGG - Intergenic
1056604839 9:88077417-88077439 TTCCCCTCCTGGGCCTGGCTGGG + Intergenic
1056665259 9:88576607-88576629 TGCCCCTCCCGCACCTCCATTGG - Intronic
1056745429 9:89297116-89297138 CACCCCTCCTGGGACTCCCTTGG + Intergenic
1056798707 9:89676543-89676565 GGCACCTGCTGGGCCTCCCAGGG - Intergenic
1057211276 9:93202404-93202426 TGCCCCTCCGGCGCTTCCGTGGG + Intronic
1057338517 9:94177936-94177958 AGCCCCTCCTGGGCCTCTGATGG - Intergenic
1057989289 9:99750674-99750696 TCCCCTTCCTGGGACTCCCGTGG - Intergenic
1058397222 9:104568516-104568538 TTGCCCTCCTCGGCCTCCCAAGG - Intergenic
1059757924 9:117311038-117311060 TTCCCCTACTGGGGCTCCCTGGG + Intronic
1060048900 9:120362823-120362845 TTCCCCTGCTGGGACTCACTCGG - Intergenic
1060188015 9:121575670-121575692 TTCCCCTCACTGGCCTCCCTGGG + Intronic
1060661904 9:125409362-125409384 GCCCCCTCCAGGGGCTCCCTGGG - Intergenic
1060892185 9:127195882-127195904 AGCTCCTCCAGGGCCTGCCTAGG - Intronic
1061095867 9:128456500-128456522 TGCCCCTCCTCTGCCGCCCGCGG + Exonic
1061233194 9:129326894-129326916 TTCCCATCCTGGGCCTCACAGGG + Intergenic
1061303181 9:129718106-129718128 TGCCACTCCAGGACCTCCCCAGG + Intronic
1061421739 9:130476518-130476540 TGCCGCTCCTGGGAAGCCCTCGG + Intronic
1061667070 9:132166784-132166806 TGCCTCTCCAGGGCTTCTCTGGG + Exonic
1061747929 9:132753650-132753672 CGCCCCAGCTGGGCCACCCTGGG - Intronic
1061975755 9:134067495-134067517 TCCCCCTCCGCGTCCTCCCTGGG + Intronic
1061978762 9:134087799-134087821 TGCCACTGCCGGGACTCCCTGGG - Intergenic
1062000531 9:134213682-134213704 GGCCCCTCCTGGACCTCCCCTGG - Intergenic
1062009663 9:134260217-134260239 TGCCCATCCGGGGCCTGCCCAGG + Intergenic
1062193054 9:135257491-135257513 TGCCCTTCCTGAGCGGCCCTAGG + Intergenic
1062274989 9:135726298-135726320 GGGCCCTCTGGGGCCTCCCTGGG + Intronic
1062432238 9:136531382-136531404 TGCCACTCCTGTGCCACCCTGGG - Intronic
1062459919 9:136658763-136658785 CGCCCCTCCTCGGCCTTGCTGGG - Intergenic
1062514710 9:136926838-136926860 CTCCTCTCCTGGGCCTCCCCAGG + Intronic
1062548844 9:137076999-137077021 TTCCCCTGCGGGGCGTCCCTGGG + Intergenic
1062574223 9:137199114-137199136 TCCTCCTCCTCGGCCTCCCGTGG + Exonic
1062707393 9:137953118-137953140 AGCCCCTCCTGTCCCACCCTGGG + Intronic
1062715450 9:138007966-138007988 AGCCCCTGCTGGGCCAGCCTAGG - Intronic
1185622939 X:1464608-1464630 TTCCGCACCTGGGCCTCCCGTGG + Exonic
1186355368 X:8784225-8784247 GCCCTATCCTGGGCCTCCCTGGG + Intergenic
1186384863 X:9099709-9099731 TGCCCATCCTGAGCCACTCTGGG - Intronic
1186458210 X:9727500-9727522 TGCCCCGCCCAGGCCTCGCTCGG - Intronic
1186849891 X:13569821-13569843 TCCTCCTCCTGAGCCCCCCTCGG - Exonic
1186855828 X:13625219-13625241 TGCTCCTCCTGCACCTCCATTGG + Intronic
1192208666 X:69112836-69112858 TGCCCCTCCTTGGTGGCCCTTGG + Intergenic
1192439643 X:71165248-71165270 TGCCCCTCCAGGGACTACCCTGG + Intronic
1195687920 X:107602303-107602325 TCTACCTCCTTGGCCTCCCTGGG - Exonic
1196288888 X:113915594-113915616 TGCCCCACCTGGGCCTCTCTCGG - Intergenic
1196800372 X:119537886-119537908 GCCCCATCCTGGGCCTTCCTGGG + Intergenic
1196814511 X:119654249-119654271 TCTCTTTCCTGGGCCTCCCTGGG + Intronic
1197879277 X:131148114-131148136 TGCACCTCCTGCAGCTCCCTTGG + Intergenic
1199399165 X:147376726-147376748 TGCCCCTGCTGTTCCTCACTGGG - Intergenic
1199416058 X:147584347-147584369 TCACCCGCCTGGGCCTCCCAAGG + Intergenic
1199679201 X:150213989-150214011 TGACTTTGCTGGGCCTCCCTGGG - Intergenic
1200047157 X:153409150-153409172 TGCCCGTCCTGGGCCAGCCTAGG + Intergenic
1200088985 X:153625649-153625671 TGCCCATCGTGGGCCAGCCTGGG - Intergenic
1201977644 Y:19869879-19869901 TACACCTCCTGCCCCTCCCTAGG - Intergenic
1202379170 Y:24261114-24261136 TGCCCAGCAGGGGCCTCCCTGGG + Intergenic
1202491612 Y:25409007-25409029 TGCCCAGCAGGGGCCTCCCTGGG - Intergenic