ID: 1086728777

View in Genome Browser
Species Human (GRCh38)
Location 11:90222751-90222773
Sequence TGCCCCTCCTGGGCCTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 1, 2: 12, 3: 78, 4: 531}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086728777_1086728784 -2 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728784 11:90222772-90222794 CATGGACCTGGGGCCGCGCGAGG 0: 1
1: 0
2: 2
3: 19
4: 184
1086728777_1086728785 2 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728785 11:90222776-90222798 GACCTGGGGCCGCGCGAGGACGG 0: 1
1: 0
2: 0
3: 19
4: 190
1086728777_1086728790 30 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728790 11:90222804-90222826 GGAGATCCGCGGACACCCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 69
1086728777_1086728787 9 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728787 11:90222783-90222805 GGCCGCGCGAGGACGGCTGCAGG 0: 1
1: 0
2: 3
3: 12
4: 139
1086728777_1086728789 19 Left 1086728777 11:90222751-90222773 CCAAGGGAGGCCCAGGAGGGGCA 0: 1
1: 1
2: 12
3: 78
4: 531
Right 1086728789 11:90222793-90222815 GGACGGCTGCAGGAGATCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086728777 Original CRISPR TGCCCCTCCTGGGCCTCCCT TGG (reversed) Intronic