ID: 1086730963

View in Genome Browser
Species Human (GRCh38)
Location 11:90249232-90249254
Sequence TTTTAGTTAGATATATGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086730963_1086730965 -10 Left 1086730963 11:90249232-90249254 CCACTCCATATATCTAACTAAAA No data
Right 1086730965 11:90249245-90249267 CTAACTAAAATGTGAACTCCTGG No data
1086730963_1086730966 -6 Left 1086730963 11:90249232-90249254 CCACTCCATATATCTAACTAAAA No data
Right 1086730966 11:90249249-90249271 CTAAAATGTGAACTCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086730963 Original CRISPR TTTTAGTTAGATATATGGAG TGG (reversed) Intergenic
No off target data available for this crispr