ID: 1086739743

View in Genome Browser
Species Human (GRCh38)
Location 11:90352498-90352520
Sequence ACTTATTTATGGAGGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086739736_1086739743 -4 Left 1086739736 11:90352479-90352501 CCAAAGTGCCTCTACTAAGACTT No data
Right 1086739743 11:90352498-90352520 ACTTATTTATGGAGGAGGGGTGG No data
1086739735_1086739743 25 Left 1086739735 11:90352450-90352472 CCGTGCTCATACTCATATCTGCA No data
Right 1086739743 11:90352498-90352520 ACTTATTTATGGAGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086739743 Original CRISPR ACTTATTTATGGAGGAGGGG TGG Intergenic
No off target data available for this crispr