ID: 1086749782

View in Genome Browser
Species Human (GRCh38)
Location 11:90477473-90477495
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086749782_1086749785 4 Left 1086749782 11:90477473-90477495 CCCATGCAATTCTGTAGGAGTTG No data
Right 1086749785 11:90477500-90477522 TTAATGGCATTTTTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086749782 Original CRISPR CAACTCCTACAGAATTGCAT GGG (reversed) Intergenic
No off target data available for this crispr