ID: 1086750889

View in Genome Browser
Species Human (GRCh38)
Location 11:90491841-90491863
Sequence CTTTATGAGCAGGTTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086750883_1086750889 22 Left 1086750883 11:90491796-90491818 CCATTAAACCTCTTTCTTTTGTA 0: 772
1: 1406
2: 1813
3: 1598
4: 1768
Right 1086750889 11:90491841-90491863 CTTTATGAGCAGGTTGAAAATGG No data
1086750884_1086750889 14 Left 1086750884 11:90491804-90491826 CCTCTTTCTTTTGTAAATTGTCC 0: 112
1: 1762
2: 1814
3: 1964
4: 6516
Right 1086750889 11:90491841-90491863 CTTTATGAGCAGGTTGAAAATGG No data
1086750887_1086750889 -7 Left 1086750887 11:90491825-90491847 CCAGTCTTGGGTATGTCTTTATG 0: 27
1: 2292
2: 4380
3: 7606
4: 9142
Right 1086750889 11:90491841-90491863 CTTTATGAGCAGGTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086750889 Original CRISPR CTTTATGAGCAGGTTGAAAA TGG Intergenic
No off target data available for this crispr