ID: 1086759214

View in Genome Browser
Species Human (GRCh38)
Location 11:90606098-90606120
Sequence AGGTGAGGAGTTGAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086759210_1086759214 -4 Left 1086759210 11:90606079-90606101 CCAGCTACTTGGGGTGAGAAGGT No data
Right 1086759214 11:90606098-90606120 AGGTGAGGAGTTGAGGCAGGAGG No data
1086759207_1086759214 5 Left 1086759207 11:90606070-90606092 CCTTTAATTCCAGCTACTTGGGG No data
Right 1086759214 11:90606098-90606120 AGGTGAGGAGTTGAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086759214 Original CRISPR AGGTGAGGAGTTGAGGCAGG AGG Intergenic
No off target data available for this crispr