ID: 1086759379

View in Genome Browser
Species Human (GRCh38)
Location 11:90608379-90608401
Sequence TAGCAACAACTGCAACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086759379_1086759380 -9 Left 1086759379 11:90608379-90608401 CCTTTTTGTTGCAGTTGTTGCTA No data
Right 1086759380 11:90608393-90608415 TTGTTGCTAGAAAACATAATCGG No data
1086759379_1086759381 -5 Left 1086759379 11:90608379-90608401 CCTTTTTGTTGCAGTTGTTGCTA No data
Right 1086759381 11:90608397-90608419 TGCTAGAAAACATAATCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086759379 Original CRISPR TAGCAACAACTGCAACAAAA AGG (reversed) Intergenic
No off target data available for this crispr