ID: 1086759950

View in Genome Browser
Species Human (GRCh38)
Location 11:90616208-90616230
Sequence ATGAAGAAGCAGCATGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086759950_1086759951 28 Left 1086759950 11:90616208-90616230 CCATGTTCATGCTGCTTCTTCAT No data
Right 1086759951 11:90616259-90616281 TTTGCTTTATTTTAAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086759950 Original CRISPR ATGAAGAAGCAGCATGAACA TGG (reversed) Intergenic
No off target data available for this crispr