ID: 1086766894

View in Genome Browser
Species Human (GRCh38)
Location 11:90706729-90706751
Sequence CTGCCTTCCTGCTACTACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086766893_1086766894 -3 Left 1086766893 11:90706709-90706731 CCAAAGTGTCATTCTAGGATCTG No data
Right 1086766894 11:90706729-90706751 CTGCCTTCCTGCTACTACTTTGG No data
1086766891_1086766894 7 Left 1086766891 11:90706699-90706721 CCATTCAGCTCCAAAGTGTCATT No data
Right 1086766894 11:90706729-90706751 CTGCCTTCCTGCTACTACTTTGG No data
1086766890_1086766894 15 Left 1086766890 11:90706691-90706713 CCTAAATGCCATTCAGCTCCAAA No data
Right 1086766894 11:90706729-90706751 CTGCCTTCCTGCTACTACTTTGG No data
1086766889_1086766894 21 Left 1086766889 11:90706685-90706707 CCTTTTCCTAAATGCCATTCAGC No data
Right 1086766894 11:90706729-90706751 CTGCCTTCCTGCTACTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086766894 Original CRISPR CTGCCTTCCTGCTACTACTT TGG Intergenic
No off target data available for this crispr