ID: 1086771681

View in Genome Browser
Species Human (GRCh38)
Location 11:90774898-90774920
Sequence TGTCAGGGTTAGACCTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086771677_1086771681 -2 Left 1086771677 11:90774877-90774899 CCCACACACTGAGGAAAGATGTG No data
Right 1086771681 11:90774898-90774920 TGTCAGGGTTAGACCTGAAGAGG No data
1086771678_1086771681 -3 Left 1086771678 11:90774878-90774900 CCACACACTGAGGAAAGATGTGT No data
Right 1086771681 11:90774898-90774920 TGTCAGGGTTAGACCTGAAGAGG No data
1086771676_1086771681 -1 Left 1086771676 11:90774876-90774898 CCCCACACACTGAGGAAAGATGT No data
Right 1086771681 11:90774898-90774920 TGTCAGGGTTAGACCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086771681 Original CRISPR TGTCAGGGTTAGACCTGAAG AGG Intergenic
No off target data available for this crispr