ID: 1086775306

View in Genome Browser
Species Human (GRCh38)
Location 11:90823795-90823817
Sequence CAGTAAAAGGTGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086775303_1086775306 3 Left 1086775303 11:90823769-90823791 CCTAGGTTTTATGGCGTGGTTCA No data
Right 1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086775306 Original CRISPR CAGTAAAAGGTGAAGGAGAC AGG Intergenic
No off target data available for this crispr