ID: 1086784427

View in Genome Browser
Species Human (GRCh38)
Location 11:90949191-90949213
Sequence CAAAATGAACATTTGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086784421_1086784427 27 Left 1086784421 11:90949141-90949163 CCATTTAAGTTAGACAAAAGGAC No data
Right 1086784427 11:90949191-90949213 CAAAATGAACATTTGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086784427 Original CRISPR CAAAATGAACATTTGGAGGT AGG Intergenic
No off target data available for this crispr