ID: 1086785102

View in Genome Browser
Species Human (GRCh38)
Location 11:90958996-90959018
Sequence GTTTTTATGGTAATTGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086785102_1086785108 9 Left 1086785102 11:90958996-90959018 CCATTCACAATTACCATAAAAAC No data
Right 1086785108 11:90959028-90959050 CCTAGGAATACAGCTAATCGGGG No data
1086785102_1086785104 -8 Left 1086785102 11:90958996-90959018 CCATTCACAATTACCATAAAAAC No data
Right 1086785104 11:90959011-90959033 ATAAAAACAATAAAATACCTAGG No data
1086785102_1086785109 12 Left 1086785102 11:90958996-90959018 CCATTCACAATTACCATAAAAAC No data
Right 1086785109 11:90959031-90959053 AGGAATACAGCTAATCGGGGAGG No data
1086785102_1086785105 7 Left 1086785102 11:90958996-90959018 CCATTCACAATTACCATAAAAAC No data
Right 1086785105 11:90959026-90959048 TACCTAGGAATACAGCTAATCGG No data
1086785102_1086785106 8 Left 1086785102 11:90958996-90959018 CCATTCACAATTACCATAAAAAC No data
Right 1086785106 11:90959027-90959049 ACCTAGGAATACAGCTAATCGGG 0: 43
1: 458
2: 1297
3: 1553
4: 2929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086785102 Original CRISPR GTTTTTATGGTAATTGTGAA TGG (reversed) Intergenic
No off target data available for this crispr