ID: 1086787171

View in Genome Browser
Species Human (GRCh38)
Location 11:90983247-90983269
Sequence GTTGCTTGTGCTTCACAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086787164_1086787171 29 Left 1086787164 11:90983195-90983217 CCACTTTCAGGTAGGACTGTAGG No data
Right 1086787171 11:90983247-90983269 GTTGCTTGTGCTTCACAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086787171 Original CRISPR GTTGCTTGTGCTTCACAGTT GGG Intergenic
No off target data available for this crispr