ID: 1086790128

View in Genome Browser
Species Human (GRCh38)
Location 11:91026747-91026769
Sequence TCTCTTAACCATAATAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086790128_1086790132 16 Left 1086790128 11:91026747-91026769 CCTACCCTATTATGGTTAAGAGA No data
Right 1086790132 11:91026786-91026808 CGCAGTTACATTCAGAGACTAGG No data
1086790128_1086790133 19 Left 1086790128 11:91026747-91026769 CCTACCCTATTATGGTTAAGAGA No data
Right 1086790133 11:91026789-91026811 AGTTACATTCAGAGACTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086790128 Original CRISPR TCTCTTAACCATAATAGGGT AGG (reversed) Intergenic
No off target data available for this crispr