ID: 1086797925

View in Genome Browser
Species Human (GRCh38)
Location 11:91132257-91132279
Sequence CAGATTTAGCAGCTTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086797925_1086797931 9 Left 1086797925 11:91132257-91132279 CCCAACACAAGCTGCTAAATCTG No data
Right 1086797931 11:91132289-91132311 CCACCAAAGCTTCCTACGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086797925 Original CRISPR CAGATTTAGCAGCTTGTGTT GGG (reversed) Intergenic
No off target data available for this crispr