ID: 1086800132

View in Genome Browser
Species Human (GRCh38)
Location 11:91163008-91163030
Sequence GCACATTGTAGGTTTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086800126_1086800132 14 Left 1086800126 11:91162971-91162993 CCGACGGTTTCAGGATTTTATGT No data
Right 1086800132 11:91163008-91163030 GCACATTGTAGGTTTAAAGTTGG No data
1086800125_1086800132 22 Left 1086800125 11:91162963-91162985 CCTAAACTCCGACGGTTTCAGGA No data
Right 1086800132 11:91163008-91163030 GCACATTGTAGGTTTAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086800132 Original CRISPR GCACATTGTAGGTTTAAAGT TGG Intergenic
No off target data available for this crispr