ID: 1086804232

View in Genome Browser
Species Human (GRCh38)
Location 11:91219922-91219944
Sequence CGTGTGTGTGTAATATAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086804232_1086804237 27 Left 1086804232 11:91219922-91219944 CCTGTTTATATTACACACACACG No data
Right 1086804237 11:91219972-91219994 AGTGAGGGTTTCATGATAAGAGG No data
1086804232_1086804235 12 Left 1086804232 11:91219922-91219944 CCTGTTTATATTACACACACACG No data
Right 1086804235 11:91219957-91219979 TAAACTCAAGGCCATAGTGAGGG No data
1086804232_1086804234 11 Left 1086804232 11:91219922-91219944 CCTGTTTATATTACACACACACG No data
Right 1086804234 11:91219956-91219978 TTAAACTCAAGGCCATAGTGAGG No data
1086804232_1086804233 0 Left 1086804232 11:91219922-91219944 CCTGTTTATATTACACACACACG No data
Right 1086804233 11:91219945-91219967 CACACACAACATTAAACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086804232 Original CRISPR CGTGTGTGTGTAATATAAAC AGG (reversed) Intergenic
No off target data available for this crispr