ID: 1086804234

View in Genome Browser
Species Human (GRCh38)
Location 11:91219956-91219978
Sequence TTAAACTCAAGGCCATAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086804231_1086804234 27 Left 1086804231 11:91219906-91219928 CCAGAACTCTTTGATTCCTGTTT No data
Right 1086804234 11:91219956-91219978 TTAAACTCAAGGCCATAGTGAGG No data
1086804232_1086804234 11 Left 1086804232 11:91219922-91219944 CCTGTTTATATTACACACACACG No data
Right 1086804234 11:91219956-91219978 TTAAACTCAAGGCCATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086804234 Original CRISPR TTAAACTCAAGGCCATAGTG AGG Intergenic
No off target data available for this crispr