ID: 1086806319

View in Genome Browser
Species Human (GRCh38)
Location 11:91247257-91247279
Sequence ATGTGTGTGTGGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086806311_1086806319 15 Left 1086806311 11:91247219-91247241 CCCACCAGAAAGTACATTTGGAC No data
Right 1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG No data
1086806313_1086806319 11 Left 1086806313 11:91247223-91247245 CCAGAAAGTACATTTGGACTAGG No data
Right 1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG No data
1086806312_1086806319 14 Left 1086806312 11:91247220-91247242 CCACCAGAAAGTACATTTGGACT No data
Right 1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086806319 Original CRISPR ATGTGTGTGTGGAGGGGAGA AGG Intergenic
No off target data available for this crispr