ID: 1086806539

View in Genome Browser
Species Human (GRCh38)
Location 11:91250964-91250986
Sequence ATAGTTCTGCACATGTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086806539_1086806541 -5 Left 1086806539 11:91250964-91250986 CCAGTATACATGTGCAGAACTAT No data
Right 1086806541 11:91250982-91251004 ACTATGCAGGTTTGTTAAGTAGG No data
1086806539_1086806543 14 Left 1086806539 11:91250964-91250986 CCAGTATACATGTGCAGAACTAT No data
Right 1086806543 11:91251001-91251023 TAGGTATACATGTGCCATGGTGG 0: 2643
1: 6365
2: 26338
3: 13070
4: 5674
1086806539_1086806542 11 Left 1086806539 11:91250964-91250986 CCAGTATACATGTGCAGAACTAT No data
Right 1086806542 11:91250998-91251020 AAGTAGGTATACATGTGCCATGG 0: 3
1: 163
2: 3131
3: 5365
4: 5538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086806539 Original CRISPR ATAGTTCTGCACATGTATAC TGG (reversed) Intergenic
No off target data available for this crispr