ID: 1086809521

View in Genome Browser
Species Human (GRCh38)
Location 11:91290375-91290397
Sequence ATTCAATCCATCATTTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086809521_1086809524 22 Left 1086809521 11:91290375-91290397 CCAACACAAATGATGGATTGAAT No data
Right 1086809524 11:91290420-91290442 TAACACTCAATAAAATTCTCTGG No data
1086809521_1086809522 -2 Left 1086809521 11:91290375-91290397 CCAACACAAATGATGGATTGAAT No data
Right 1086809522 11:91290396-91290418 ATAATTTTAACTAAAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086809521 Original CRISPR ATTCAATCCATCATTTGTGT TGG (reversed) Intergenic
No off target data available for this crispr