ID: 1086818683

View in Genome Browser
Species Human (GRCh38)
Location 11:91406579-91406601
Sequence TGTCCCATGGGGCAGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086818674_1086818683 27 Left 1086818674 11:91406529-91406551 CCTGCTCTGGCCAATGGCTCCAG No data
Right 1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG No data
1086818676_1086818683 17 Left 1086818676 11:91406539-91406561 CCAATGGCTCCAGTGCTGGCTCA No data
Right 1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG No data
1086818678_1086818683 -7 Left 1086818678 11:91406563-91406585 CCTCACTGCTACTTCCTGTCCCA No data
Right 1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG No data
1086818677_1086818683 8 Left 1086818677 11:91406548-91406570 CCAGTGCTGGCTCAGCCTCACTG No data
Right 1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG No data
1086818673_1086818683 28 Left 1086818673 11:91406528-91406550 CCCTGCTCTGGCCAATGGCTCCA No data
Right 1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086818683 Original CRISPR TGTCCCATGGGGCAGCTGCC TGG Intergenic
No off target data available for this crispr