ID: 1086819026

View in Genome Browser
Species Human (GRCh38)
Location 11:91412079-91412101
Sequence GGAATGGCGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086819026_1086819040 12 Left 1086819026 11:91412079-91412101 CCCCCTGGGGTTCACGCCATTCC No data
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data
1086819026_1086819031 -6 Left 1086819026 11:91412079-91412101 CCCCCTGGGGTTCACGCCATTCC No data
Right 1086819031 11:91412096-91412118 CATTCCCCTGCCTCAGCCCCCGG No data
1086819026_1086819036 4 Left 1086819026 11:91412079-91412101 CCCCCTGGGGTTCACGCCATTCC No data
Right 1086819036 11:91412106-91412128 CCTCAGCCCCCGGAGTAGCTTGG 0: 65
1: 7215
2: 219117
3: 281072
4: 176597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086819026 Original CRISPR GGAATGGCGTGAACCCCAGG GGG (reversed) Intergenic
No off target data available for this crispr