ID: 1086819036

View in Genome Browser
Species Human (GRCh38)
Location 11:91412106-91412128
Sequence CCTCAGCCCCCGGAGTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 684066
Summary {0: 65, 1: 7215, 2: 219117, 3: 281072, 4: 176597}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086819029_1086819036 1 Left 1086819029 11:91412082-91412104 CCTGGGGTTCACGCCATTCCCCT 0: 7
1: 666
2: 925
3: 1379
4: 3220
Right 1086819036 11:91412106-91412128 CCTCAGCCCCCGGAGTAGCTTGG 0: 65
1: 7215
2: 219117
3: 281072
4: 176597
1086819025_1086819036 7 Left 1086819025 11:91412076-91412098 CCGCCCCCTGGGGTTCACGCCAT 0: 286
1: 279
2: 273
3: 356
4: 1013
Right 1086819036 11:91412106-91412128 CCTCAGCCCCCGGAGTAGCTTGG 0: 65
1: 7215
2: 219117
3: 281072
4: 176597
1086819027_1086819036 3 Left 1086819027 11:91412080-91412102 CCCCTGGGGTTCACGCCATTCCC No data
Right 1086819036 11:91412106-91412128 CCTCAGCCCCCGGAGTAGCTTGG 0: 65
1: 7215
2: 219117
3: 281072
4: 176597
1086819028_1086819036 2 Left 1086819028 11:91412081-91412103 CCCTGGGGTTCACGCCATTCCCC No data
Right 1086819036 11:91412106-91412128 CCTCAGCCCCCGGAGTAGCTTGG 0: 65
1: 7215
2: 219117
3: 281072
4: 176597
1086819026_1086819036 4 Left 1086819026 11:91412079-91412101 CCCCCTGGGGTTCACGCCATTCC No data
Right 1086819036 11:91412106-91412128 CCTCAGCCCCCGGAGTAGCTTGG 0: 65
1: 7215
2: 219117
3: 281072
4: 176597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086819036 Original CRISPR CCTCAGCCCCCGGAGTAGCT TGG Intergenic
Too many off-targets to display for this crispr