ID: 1086819040

View in Genome Browser
Species Human (GRCh38)
Location 11:91412114-91412136
Sequence CCCGGAGTAGCTTGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086819029_1086819040 9 Left 1086819029 11:91412082-91412104 CCTGGGGTTCACGCCATTCCCCT 0: 7
1: 666
2: 925
3: 1379
4: 3220
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data
1086819028_1086819040 10 Left 1086819028 11:91412081-91412103 CCCTGGGGTTCACGCCATTCCCC No data
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data
1086819033_1086819040 -10 Left 1086819033 11:91412101-91412123 CCCTGCCTCAGCCCCCGGAGTAG No data
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data
1086819030_1086819040 -4 Left 1086819030 11:91412095-91412117 CCATTCCCCTGCCTCAGCCCCCG No data
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data
1086819032_1086819040 -9 Left 1086819032 11:91412100-91412122 CCCCTGCCTCAGCCCCCGGAGTA No data
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data
1086819026_1086819040 12 Left 1086819026 11:91412079-91412101 CCCCCTGGGGTTCACGCCATTCC No data
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data
1086819025_1086819040 15 Left 1086819025 11:91412076-91412098 CCGCCCCCTGGGGTTCACGCCAT 0: 286
1: 279
2: 273
3: 356
4: 1013
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data
1086819027_1086819040 11 Left 1086819027 11:91412080-91412102 CCCCTGGGGTTCACGCCATTCCC No data
Right 1086819040 11:91412114-91412136 CCCGGAGTAGCTTGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086819040 Original CRISPR CCCGGAGTAGCTTGGACTAC AGG Intergenic
No off target data available for this crispr