ID: 1086823834

View in Genome Browser
Species Human (GRCh38)
Location 11:91470613-91470635
Sequence CTAGTTCACCTGGAATCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086823834_1086823837 0 Left 1086823834 11:91470613-91470635 CCACCTGATTCCAGGTGAACTAG No data
Right 1086823837 11:91470636-91470658 ACATGCCATTTCTCTTAGCATGG No data
1086823834_1086823841 24 Left 1086823834 11:91470613-91470635 CCACCTGATTCCAGGTGAACTAG No data
Right 1086823841 11:91470660-91470682 TCGTTTGGTGAGACCAGAGTGGG No data
1086823834_1086823839 9 Left 1086823834 11:91470613-91470635 CCACCTGATTCCAGGTGAACTAG No data
Right 1086823839 11:91470645-91470667 TTCTCTTAGCATGGCTCGTTTGG No data
1086823834_1086823840 23 Left 1086823834 11:91470613-91470635 CCACCTGATTCCAGGTGAACTAG No data
Right 1086823840 11:91470659-91470681 CTCGTTTGGTGAGACCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086823834 Original CRISPR CTAGTTCACCTGGAATCAGG TGG (reversed) Intergenic
No off target data available for this crispr