ID: 1086825525

View in Genome Browser
Species Human (GRCh38)
Location 11:91490363-91490385
Sequence AGGAAGGAGCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086825525_1086825533 23 Left 1086825525 11:91490363-91490385 CCTTCCTCTTTCTGCTCCTTCCT No data
Right 1086825533 11:91490409-91490431 TCTAAATTGACTCAGCTCTTAGG No data
1086825525_1086825534 28 Left 1086825525 11:91490363-91490385 CCTTCCTCTTTCTGCTCCTTCCT No data
Right 1086825534 11:91490414-91490436 ATTGACTCAGCTCTTAGGTAAGG No data
1086825525_1086825529 -3 Left 1086825525 11:91490363-91490385 CCTTCCTCTTTCTGCTCCTTCCT No data
Right 1086825529 11:91490383-91490405 CCTCTACCCCTGAATTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086825525 Original CRISPR AGGAAGGAGCAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr