ID: 1086847921

View in Genome Browser
Species Human (GRCh38)
Location 11:91774415-91774437
Sequence AGGGAGAGCACAGCGATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086847921_1086847925 23 Left 1086847921 11:91774415-91774437 CCTAAAATCGCTGTGCTCTCCCT No data
Right 1086847925 11:91774461-91774483 TCAGCACCACAGGATGCTGATGG No data
1086847921_1086847924 13 Left 1086847921 11:91774415-91774437 CCTAAAATCGCTGTGCTCTCCCT No data
Right 1086847924 11:91774451-91774473 AAATTCTCTCTCAGCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086847921 Original CRISPR AGGGAGAGCACAGCGATTTT AGG (reversed) Intergenic