ID: 1086849024

View in Genome Browser
Species Human (GRCh38)
Location 11:91786569-91786591
Sequence CAGTGGTAATGCAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086849024_1086849029 4 Left 1086849024 11:91786569-91786591 CCATCTGCCCTGCATTACCACTG No data
Right 1086849029 11:91786596-91786618 TCAGAGCAATCTCACAAAGGTGG No data
1086849024_1086849030 23 Left 1086849024 11:91786569-91786591 CCATCTGCCCTGCATTACCACTG No data
Right 1086849030 11:91786615-91786637 GTGGAACAAGTACAAGAATGTGG No data
1086849024_1086849028 1 Left 1086849024 11:91786569-91786591 CCATCTGCCCTGCATTACCACTG No data
Right 1086849028 11:91786593-91786615 TTTTCAGAGCAATCTCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086849024 Original CRISPR CAGTGGTAATGCAGGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr