ID: 1086851507

View in Genome Browser
Species Human (GRCh38)
Location 11:91814920-91814942
Sequence TAGAAGAAGCAGGAGGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086851501_1086851507 20 Left 1086851501 11:91814877-91814899 CCTCAGTGTGGGTGGGCACCATC 0: 42
1: 233
2: 789
3: 1283
4: 1746
Right 1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG No data
1086851502_1086851507 2 Left 1086851502 11:91814895-91814917 CCATCCAATCTGCTGCAAGTGTA No data
Right 1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG No data
1086851499_1086851507 24 Left 1086851499 11:91814873-91814895 CCACCCTCAGTGTGGGTGGGCAC 0: 31
1: 208
2: 678
3: 1191
4: 1392
Right 1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG No data
1086851500_1086851507 21 Left 1086851500 11:91814876-91814898 CCCTCAGTGTGGGTGGGCACCAT 0: 36
1: 236
2: 682
3: 1102
4: 1227
Right 1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG No data
1086851504_1086851507 -2 Left 1086851504 11:91814899-91814921 CCAATCTGCTGCAAGTGTAGGTA No data
Right 1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG No data
1086851498_1086851507 25 Left 1086851498 11:91814872-91814894 CCCACCCTCAGTGTGGGTGGGCA 0: 26
1: 198
2: 666
3: 1129
4: 1180
Right 1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086851507 Original CRISPR TAGAAGAAGCAGGAGGACGA AGG Intergenic
No off target data available for this crispr