ID: 1086853693

View in Genome Browser
Species Human (GRCh38)
Location 11:91841122-91841144
Sequence GGCATCTGCACATGTGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086853693_1086853701 29 Left 1086853693 11:91841122-91841144 CCCAGCGCACATGTGCAGATGCC No data
Right 1086853701 11:91841174-91841196 AGAGTTCCATCTCTATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086853693 Original CRISPR GGCATCTGCACATGTGCGCT GGG (reversed) Intergenic