ID: 1086853701

View in Genome Browser
Species Human (GRCh38)
Location 11:91841174-91841196
Sequence AGAGTTCCATCTCTATCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086853692_1086853701 30 Left 1086853692 11:91841121-91841143 CCCCAGCGCACATGTGCAGATGC No data
Right 1086853701 11:91841174-91841196 AGAGTTCCATCTCTATCTCTAGG No data
1086853697_1086853701 4 Left 1086853697 11:91841147-91841169 CCTGCTAGGATACCCAGTGTCAA No data
Right 1086853701 11:91841174-91841196 AGAGTTCCATCTCTATCTCTAGG No data
1086853693_1086853701 29 Left 1086853693 11:91841122-91841144 CCCAGCGCACATGTGCAGATGCC No data
Right 1086853701 11:91841174-91841196 AGAGTTCCATCTCTATCTCTAGG No data
1086853694_1086853701 28 Left 1086853694 11:91841123-91841145 CCAGCGCACATGTGCAGATGCCT No data
Right 1086853701 11:91841174-91841196 AGAGTTCCATCTCTATCTCTAGG No data
1086853699_1086853701 -9 Left 1086853699 11:91841160-91841182 CCAGTGTCAAGACCAGAGTTCCA No data
Right 1086853701 11:91841174-91841196 AGAGTTCCATCTCTATCTCTAGG No data
1086853696_1086853701 8 Left 1086853696 11:91841143-91841165 CCTGCCTGCTAGGATACCCAGTG No data
Right 1086853701 11:91841174-91841196 AGAGTTCCATCTCTATCTCTAGG No data
1086853698_1086853701 -8 Left 1086853698 11:91841159-91841181 CCCAGTGTCAAGACCAGAGTTCC No data
Right 1086853701 11:91841174-91841196 AGAGTTCCATCTCTATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086853701 Original CRISPR AGAGTTCCATCTCTATCTCT AGG Intergenic
No off target data available for this crispr