ID: 1086853703

View in Genome Browser
Species Human (GRCh38)
Location 11:91841202-91841224
Sequence GGAATTGTATCTAAAGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086853703_1086853708 2 Left 1086853703 11:91841202-91841224 CCCATAGCTTTAGATACAATTCC No data
Right 1086853708 11:91841227-91841249 TTCCTCTCTGACTTTGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086853703 Original CRISPR GGAATTGTATCTAAAGCTAT GGG (reversed) Intergenic
No off target data available for this crispr