ID: 1086854927

View in Genome Browser
Species Human (GRCh38)
Location 11:91854750-91854772
Sequence GAGCTAGGGCCACCTAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086854922_1086854927 3 Left 1086854922 11:91854724-91854746 CCACTGTGACTGGTGGACCTGTG No data
Right 1086854927 11:91854750-91854772 GAGCTAGGGCCACCTAACTGTGG No data
1086854918_1086854927 13 Left 1086854918 11:91854714-91854736 CCCAGGGTTGCCACTGTGACTGG No data
Right 1086854927 11:91854750-91854772 GAGCTAGGGCCACCTAACTGTGG No data
1086854920_1086854927 12 Left 1086854920 11:91854715-91854737 CCAGGGTTGCCACTGTGACTGGT No data
Right 1086854927 11:91854750-91854772 GAGCTAGGGCCACCTAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086854927 Original CRISPR GAGCTAGGGCCACCTAACTG TGG Intergenic