ID: 1086855223

View in Genome Browser
Species Human (GRCh38)
Location 11:91858117-91858139
Sequence GCAGCGAATCAGATTCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086855223_1086855226 13 Left 1086855223 11:91858117-91858139 CCTGCATGAATCTGATTCGCTGC No data
Right 1086855226 11:91858153-91858175 ACATAAACCAGTGTCTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086855223 Original CRISPR GCAGCGAATCAGATTCATGC AGG (reversed) Intergenic
No off target data available for this crispr