ID: 1086855440

View in Genome Browser
Species Human (GRCh38)
Location 11:91860106-91860128
Sequence ATGTGGAAGAGGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086855440_1086855447 17 Left 1086855440 11:91860106-91860128 CCCTCCACTTTCCTCTTCCACAT No data
Right 1086855447 11:91860146-91860168 TTACTGCACTTTACTTTCATGGG No data
1086855440_1086855452 27 Left 1086855440 11:91860106-91860128 CCCTCCACTTTCCTCTTCCACAT No data
Right 1086855452 11:91860156-91860178 TTACTTTCATGGGGGTGTAGGGG No data
1086855440_1086855448 18 Left 1086855440 11:91860106-91860128 CCCTCCACTTTCCTCTTCCACAT No data
Right 1086855448 11:91860147-91860169 TACTGCACTTTACTTTCATGGGG No data
1086855440_1086855451 26 Left 1086855440 11:91860106-91860128 CCCTCCACTTTCCTCTTCCACAT No data
Right 1086855451 11:91860155-91860177 TTTACTTTCATGGGGGTGTAGGG No data
1086855440_1086855449 19 Left 1086855440 11:91860106-91860128 CCCTCCACTTTCCTCTTCCACAT No data
Right 1086855449 11:91860148-91860170 ACTGCACTTTACTTTCATGGGGG No data
1086855440_1086855446 16 Left 1086855440 11:91860106-91860128 CCCTCCACTTTCCTCTTCCACAT No data
Right 1086855446 11:91860145-91860167 TTTACTGCACTTTACTTTCATGG No data
1086855440_1086855450 25 Left 1086855440 11:91860106-91860128 CCCTCCACTTTCCTCTTCCACAT No data
Right 1086855450 11:91860154-91860176 CTTTACTTTCATGGGGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086855440 Original CRISPR ATGTGGAAGAGGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr