ID: 1086872676 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:92057663-92057685 |
| Sequence | CAGAAAGAATATCTGGTACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1086872673_1086872676 | 12 | Left | 1086872673 | 11:92057628-92057650 | CCAGCTTGTCAGAGAGGGGAGAC | No data | ||
| Right | 1086872676 | 11:92057663-92057685 | CAGAAAGAATATCTGGTACAAGG | No data | ||||
| 1086872674_1086872676 | -10 | Left | 1086872674 | 11:92057650-92057672 | CCAGTGTTTTAAGCAGAAAGAAT | No data | ||
| Right | 1086872676 | 11:92057663-92057685 | CAGAAAGAATATCTGGTACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1086872676 | Original CRISPR | CAGAAAGAATATCTGGTACA AGG | Intergenic | ||
| No off target data available for this crispr | |||||