ID: 1086872676

View in Genome Browser
Species Human (GRCh38)
Location 11:92057663-92057685
Sequence CAGAAAGAATATCTGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086872673_1086872676 12 Left 1086872673 11:92057628-92057650 CCAGCTTGTCAGAGAGGGGAGAC No data
Right 1086872676 11:92057663-92057685 CAGAAAGAATATCTGGTACAAGG No data
1086872674_1086872676 -10 Left 1086872674 11:92057650-92057672 CCAGTGTTTTAAGCAGAAAGAAT No data
Right 1086872676 11:92057663-92057685 CAGAAAGAATATCTGGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086872676 Original CRISPR CAGAAAGAATATCTGGTACA AGG Intergenic
No off target data available for this crispr