ID: 1086878343

View in Genome Browser
Species Human (GRCh38)
Location 11:92124952-92124974
Sequence AGCACACTAGGTTTTTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086878340_1086878343 1 Left 1086878340 11:92124928-92124950 CCTGAAACTGCACAGTTGCAGGC No data
Right 1086878343 11:92124952-92124974 AGCACACTAGGTTTTTAGATTGG No data
1086878338_1086878343 2 Left 1086878338 11:92124927-92124949 CCCTGAAACTGCACAGTTGCAGG No data
Right 1086878343 11:92124952-92124974 AGCACACTAGGTTTTTAGATTGG No data
1086878337_1086878343 11 Left 1086878337 11:92124918-92124940 CCTTCTCAGCCCTGAAACTGCAC No data
Right 1086878343 11:92124952-92124974 AGCACACTAGGTTTTTAGATTGG No data
1086878336_1086878343 25 Left 1086878336 11:92124904-92124926 CCAACTACAGTCTTCCTTCTCAG No data
Right 1086878343 11:92124952-92124974 AGCACACTAGGTTTTTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086878343 Original CRISPR AGCACACTAGGTTTTTAGAT TGG Intergenic
No off target data available for this crispr