ID: 1086879565

View in Genome Browser
Species Human (GRCh38)
Location 11:92137621-92137643
Sequence GCCAGGGAGTTCAGGGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086879557_1086879565 8 Left 1086879557 11:92137590-92137612 CCAACAAAGTGAAGAAAGCTATT No data
Right 1086879565 11:92137621-92137643 GCCAGGGAGTTCAGGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086879565 Original CRISPR GCCAGGGAGTTCAGGGGAAT TGG Intergenic
No off target data available for this crispr