ID: 1086880602

View in Genome Browser
Species Human (GRCh38)
Location 11:92149172-92149194
Sequence AGACTGATCCTACTATAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086880602_1086880606 10 Left 1086880602 11:92149172-92149194 CCCACCTATAGTAGGATCAGTCT No data
Right 1086880606 11:92149205-92149227 TCAGTCTAGAATATGGTATGTGG No data
1086880602_1086880605 3 Left 1086880602 11:92149172-92149194 CCCACCTATAGTAGGATCAGTCT No data
Right 1086880605 11:92149198-92149220 AAAGATCTCAGTCTAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086880602 Original CRISPR AGACTGATCCTACTATAGGT GGG (reversed) Intergenic
No off target data available for this crispr