ID: 1086882739

View in Genome Browser
Species Human (GRCh38)
Location 11:92169042-92169064
Sequence CTCTCATCTCCCAAGACGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086882735_1086882739 -5 Left 1086882735 11:92169024-92169046 CCTTTTCCTTAAAGCTTTCTCTC No data
Right 1086882739 11:92169042-92169064 CTCTCATCTCCCAAGACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086882739 Original CRISPR CTCTCATCTCCCAAGACGGT GGG Intergenic
No off target data available for this crispr