ID: 1086888075

View in Genome Browser
Species Human (GRCh38)
Location 11:92226043-92226065
Sequence TCCCGAACCGCCCGGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888075_1086888090 24 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888090 11:92226090-92226112 GTGTGCAGGGCAAGTGTAGGGGG No data
1086888075_1086888084 10 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888084 11:92226076-92226098 CTACAGGCCAGTGTGTGTGCAGG No data
1086888075_1086888087 21 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888075_1086888088 22 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888088 11:92226088-92226110 GTGTGTGCAGGGCAAGTGTAGGG No data
1086888075_1086888080 -6 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888080 11:92226060-92226082 TCGGGACGAATCCCCTCTACAGG No data
1086888075_1086888091 30 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888091 11:92226096-92226118 AGGGCAAGTGTAGGGGGCTGAGG No data
1086888075_1086888089 23 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888089 11:92226089-92226111 TGTGTGCAGGGCAAGTGTAGGGG No data
1086888075_1086888085 11 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888085 11:92226077-92226099 TACAGGCCAGTGTGTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888075 Original CRISPR TCCCGAACCGCCCGGGAGTG GGG (reversed) Intergenic