ID: 1086888079

View in Genome Browser
Species Human (GRCh38)
Location 11:92226051-92226073
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888079_1086888090 16 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888090 11:92226090-92226112 GTGTGCAGGGCAAGTGTAGGGGG No data
1086888079_1086888088 14 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888088 11:92226088-92226110 GTGTGTGCAGGGCAAGTGTAGGG No data
1086888079_1086888087 13 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888079_1086888084 2 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888084 11:92226076-92226098 CTACAGGCCAGTGTGTGTGCAGG No data
1086888079_1086888089 15 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888089 11:92226089-92226111 TGTGTGCAGGGCAAGTGTAGGGG No data
1086888079_1086888092 23 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888092 11:92226097-92226119 GGGCAAGTGTAGGGGGCTGAGGG No data
1086888079_1086888094 30 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888094 11:92226104-92226126 TGTAGGGGGCTGAGGGGCGCTGG No data
1086888079_1086888085 3 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888085 11:92226077-92226099 TACAGGCCAGTGTGTGTGCAGGG No data
1086888079_1086888091 22 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888091 11:92226096-92226118 AGGGCAAGTGTAGGGGGCTGAGG No data
1086888079_1086888093 24 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888079 Original CRISPR GGGATTCGTCCCGAACCGCC CGG (reversed) Intergenic